Henning 201, Thursday 14:00; Chair Carl Luer;
Elasmobranch Anatomy, Development, and Physiology.
Grassmann, Michael (Aquarium of the Bay); Natanson,
Lisa (NOAA Fisheries, Narragansett, RI, United States); Slager, Christina;
Herbert, Keith (Aquarium of the Bay, San Francisco, CA, United States)
Observations of Growth and Demography in
Captive-Born Pacific Angel Sharks (Squatina californica), at Aquarium of the
Bay
In May of 2009, seven Pacific angel shark (Squatina
californica) pups were born in the Aquarium of the Bay in San Francisco,
California. This is the first reported case of successful captive-breeding for
the species. The data collected on these specimens offer a unique opportunity
to closely observe the early stages of age-related growth in Pacific angel
sharks. Over two and a half years data were regularly collected on each sharks
length, weight, average consumption, and the percentage body weight consumed.
Based on these length data, three variations of von Bertalanffy were generated.
Small sample size and rapid early growth in the population produced highly
variable data with low confidence values in the first two trials. The third
trial incorporated additional data from wild adult Pacific angel sharks that
were previously tagged or collected by Aquarium of the Bay. This growth curve
was compared to the previous trials and showed juvenile growth falling on
approximately the same curve as adults. The parameters obtained in the final
trial were also consistent with those derived from previously published data on
the growth of Pacific angel sharks, despite the differences in some life
history traits and highly variable growth rates of this specific population.
Continued observation will help determine if these parameters change with
further development, and if the initial variation in life history
characteristics will influence other traits as the sharks reach maturity.
Ford, Ryan (University of North Florida); Gelsleichter, James
(University of North Florida, Canada); Frazier, Bryan (South Carolina
Department of Natural Resources, Canada); Belcher, Carolyn (Georgia Department
of Natural Resources, Canada); Piercy, Andrew (University of North Florida,
Canada); Grubbs, R. Dean (Florida State University Coastal Marine Lab, Canada)
Reproductive Periodicity of the Blacknose Shark
(Carcharhinus acronotus) within its Atlantic Range
The blacknose shark (Carcharhinus acronotus) is a common
small coastal shark species found in near shore waters along the southeast
coast of the United States, from North Carolina into the Gulf of Mexico and
extending further south into the Bahamas. There has been some debate in recent
years over the reproductive periodicity of C. acronotus in waters off the U.S.
coast. Earlier studies have suggested that Gulf C. acronotus reproduce on an
annual basis whereas the Atlantic populations of this species may reproduce
biennially. The goal of the present study was to re-evaluate the reproductive
periodicity of the Atlantic populations of C. acronotus with the intent on
clarifying these differences. This was accomplished by examining male and
female reproductive tracts in animals caught via fishery dependant and fishery
independent gillnet and longline surveys conducted throughout the Atlantic
range of C. acronotus. Based on these data, spermatogenesis appears to occur
between late May to early July with peak sperm production occurring in June and
July. In females, follicular development is likely complete by late June-early
July with ovulation occurring shortly afterwards. Mating appears to occur
between mid- June and early July based on the presence of fresh mating scars on
females captured during this time. Current data suggests that gestation begins
late July with parturition occurring late May to early June the following year.
As observed in earlier studies, reproductive periodicity appears to be largely
biennial. However, evidence for concurrent follicular development and pregnancy
was observed in several females, suggesting that at least a portion of the
Atlantic population may reproduce on an annual basis.
Anderson, Brenda (University of North Florida);
Gelsleichter, Jim (University of North Florida, Canada); Frazier, Bryan (South
Carolina Department of Natural Resources, Canada); Belcher, Carolyn (Georgia
Department of Natural Resources, Canada)
Evaluation of Gonadal Steroid Chemiluminescence
Immunoassays (CLIA) for Non-lethal
Characterization of Reproductive Status for
Elasmobranchs
Information regarding reproductive biology is an important
element needed in the management of shark fisheries. Characterization of
reproductive cycles has historically involved culling many individuals to
examine gross morphology to assign reproductive status. This practice, while
necessary at first, is counterproductive to the conservation of these
populations. Nonlethal alternatives for determining status include using blood
samples to determine sex hormone concentrations, typically using
radioimmunoassays (RIA). However, RIAs are often problematic for many
researchers because of the use of radioactive isotopes, the need for large
sample volumes, and time and equipment needed for pre-extraction are intensive.
Commercially available chemiluminescence immunoassays (CLIA) are routinely used
for human plasma steroid evaluation, but have not been previously examined for
use with shark plasma. CLIAs use small sample volumes, equipment used is found
readily in most laboratories, and pre-extraction is typically not necessary. In
this study, we validated the use of CLIAs for the gonadal steroids 17β-estradiol,
testosterone, and progesterone for examining reproductive endocrinology of
elasmobranchs, focusing on the bonnethead shark (Sphyrna tiburo) and the
blacknose shark (Carcharhinus acronotus). Plasma steroid concentrations
measured using CLIA were compared to morphological/histological assessments of
reproductive status from a subset of culled specimens in both species as well as to previous
measurements of plasma steroid concentrations determined via RIA in S. tiburo.
Measurements of gonadal steroids using CLIA were generally higher than those
previously measured using RIA in S. tiburo. However, seasonal changes in
CLIA-determined plasma steroid concentrations were consistent with those
determined using RIA and with morphological assessments of reproductive status.
C. acronotus male testosterone CLIA concentrations were consistent with morphological assessments as well.
However, 17β-estradiol CLIA concentrations showed an unpredictable
seasonal pattern in female C. acronotus . Therefore, CLIA appears to be a
reliable method for determining reproductive status in S. tiburo males and
females and C. acronotus males but the variability in female C. acronotus
morphology and reproductive status may lend to inconsistent 17β-estradiol
CLIA concentrations.
Mull, Christopher (Simon Fraser University); Yopak,
Kara (University of Western Australia, Canada); Dulvy, Nicholas (Simon Fraser
University, Canada)
Reproductive Strategy, Brain Size and Structure
in Chrondrichthyans
Chondrichthyans have the most diverse array of
life-history and reproductive strategies of any vertebrate group, and also
exhibit broad variability in the size and complexity of the brain and its major
components (olfactory bulbs, telencephalon, diencephalon, mesencephalon,
cerebellum and medulla). In vertebrates brain tissue is expensive to produce
and maintain and represents a major energetic constraint particularly during
development, and increased encephalization may be related to maternal
investment. In mammals, larger brains are correlated with increased maternal
investment in the form of longer gestation time and the duration of lactation.
This leads to a hypothesis that brain size is related to maternal investment in
offspring. Here, we test whether additional maternal investment, beyond the
provisioning of a yolk, is associated with larger brain size across 146 species
from 6 orders of chondrichthyans using classic and phylogenetic comparative
analyses. We have previously shown that body size has a profound influence on
brain size. Controlling for body size, we find that both reproductive mode
(lecithotrophy and matrotrophy) and reproductive investment (development time
and litter size) can partially explain variation in overall adult brain size.
Matrotrophic species have larger brains across all body sizes, however,
contrary to the expectation derived from mammals, gestation length had negative
influence on brain size such that species with longer gestation typically had
smaller brains and litter size had a positive influence such that species with
larger litters tended to have larger adult brain sizes. Reproductive investment
had a significant influence on the scaling of most major regions
(telencephalon, mesencephalon, medulla and olfactory bulb), while diencephalon
and cerebellum were best predicted by brain mass alone. Our results suggest a
tentative link between reproductive mode and investment and brain size and
organization that is worth investigating further. We suggest the development of
a more refined phylogeny, detailed estimation of maternal investment, analysis
of neonatal brain size and organization and measurement of ontogenetic patterns
of brain growth may strengthen our understanding of the reproductive
investment- brain development hypothesis.
Yopak, Kara (University of Western Australia); McMeans, Bailey
(University of Windsor, Canada); Kovacs, Kit; Lydersen, Christian (Norwegian
Polar Institute, Canada); Fisk, Aaron (University of Windsor, Canada)
Can we infer function from elasmobranch brain
morphology? A study of Somniosidae
Broad variability has been documented within cartilaginous
fishes regarding the size and complexity of the brain and its major components
(olfactory bulbs, telencephalon, diencephalon, mesencephalon, cerebellum and
medulla). This variability is often associated with habitat or specific
behavior patterns, even in phylogenetically unrelated species that share
certain lifestyle characteristics. However, few studies to date have examined
neural specialization in closely related species that vary in their lifestyle
and primary habitat. Somniosidae is a member of the Order Squaliformes, which
comprises 7 genera and 17 species. They are benthopelagic fishes that range
greatly in size, distribution, and depth preference (occurring as deep as 2200m).
However, few studies have quantified interspecific brain size (encephalization)
or the relative development of major brain areas and discrete subsections of
these brain structures that receive direct sensory input (e.g. optic tectum and
the dorsal and medial octavolateral nuclei) within this group. This study
examined the brain of two large-bodied somniosids that are known to occupy
extremely cold waters of the High Arctic, S. pacificus and S. microcephalus, in
comparison to the brain morphology of closely related, deep-dwelling species
from more southerly latitudes, such as Centroselachus crepidater ,
Centroscymnus owstonii , and Proscymnodon plunketi . Brain patterns were
analyzed in relation to both phylogeny and ecology. In general, members of
Somniosidae had smaller than expected brains for their body mass. Although
closely related, the relative development of major brain areas did not track
phylogenetic groupings. In particular, development of brain regions that
receive visual input were relatively reduced in S. microcephalus, while the
olfactory regions of the brain were greatly enlarged. This species occurs at
great depths and is heavily colonized by parasitic copepods that attach to the
shark's cornea; its brain morphology might reflect a reduced reliance on vision
for survival. Although this study
was not a functional analysis, we suggest brain morphology may serve as a tool
to make predictions about the behavioral ecology, sensory specialization, and predatory
habits in cartilaginous fishes.
Luer, Carl (Mote Marine Laboratory); Walsh, Cathy; Ritchie,
Kim; Yordy, Jennifer; Miedema, Jodi (Mote Marine Laboratory, Canada); Bodine,
A.B. (Clemson University); Cannons, Andrew; Luna, Vicki (USF Center for
Biological Defense)
Antimicrobial Properties of Epidermal Mucus from
Two Species of Ray (Cownose Ray, Rhinoptera bonasus, and Atlantic Stingray,
Dasyatis sabina)
The protective secretion produced by epidermal mucus cells
in stingrays is being investigated to identify mucus-associated antimicrobial
compounds with the potential for development into novel therapeutics to treat
wound infection pathogens. Freshly obtained epidermal mucus from cownose rays
(Rhinoptera bonasus), and Atlantic stingrays (Dasyatis sabina) can be separated
by gentle centrifugation into an aqueous supernatant and a viscous pellet. The
aqueous supernatant contains at least 20 proteins/protein subunits based on SDS
polyacrylamide gel electrophoresis. Chemical extraction of fresh mucus with 1)
Tris-EDTA, 2) acetic acid and solid phase extraction, and 3) selected
surfactants (Triton X-100, Tween 80, and N-octylglucoside) results in partial
purification of mucus compounds. Fresh mucus also contains bacterial symbionts
that are not seawater contaminants. Forty-six of 384 bacterial isolates
cultured from R. bonasus and 49 of 227 isolates from D. sabina epidermal mucus
demonstrated antibiotic activity against at least one human pathogenic tester
strain in primary screens performed at Mote Marine Laboratory. Of the 46 R.
bonasus isolates, 13 demonstrated antimicrobial activity against a different
panel of pathogenic bacterial tester strains when screened at University of
South Florida Center for Biological Defense. Using the GenBank database, BLAST
searches performed on 16S rDNA sequence data identified six different genera
among 22 of the 49 D. sabina -derived bacterial isolates that produced
antibacterial compounds against various tester strains. Some of the active
isolates not genetically confirmed with the database could be undescribed organisms.
Culturable libraries of all isolates have been cryopreserved.
Walsh, Cathy (Mote Marine Laboratory); Luer, Carl; Yordy,
Jennifer; Miedema, Jodi; Leigh, Brittany; Adams, Philip (Mote Marine
Laboratory)
Epigonal Conditioned Medium from Bonnethead
Shark Induces Apoptosis in T-cell Leukemia Cells, and Preferentially Targets
Breast Cancer Cells Compared with Normal Breast Cells
Protein factors secreted into the surrounding medium by
short-term cultures of epigonal cells (epigonal conditioned medium, ECM) from
bonnethead shark (Sphyrna tiburo ) are cytotoxic against human tumor cells in
vitro. Using a T-cell leukemia cell line (Jurkat) as target cells, apoptotic
pathway intermediates affected by ECM treatment were identified through western
blotting, and protein and PCR arrays. Western blotting and gene expression
indicated significant decreases in the apoptosis inhibitor, XIAP, at both the
protein and genetic levels in response to ECM treatment. A significant increase
in expression of the adaptor protein, FADD, was observed at the protein level
in response to 2 mg/ml ECM.
Protein array analysis indicated treatments at both 1 mg/ml and 2 mg/ml
ECM resulted in greater than 120% relative increase in expression of Fas, as
well as apoptosis promoters bad and bax. At the same ECM treatments, analysis
using a human apoptosis array kit showed significant changes in expression of
some caspase genes, adaptor proteins, and death receptors. To determine effect of ECM on normal
cells, growth inhibition was measured in paired malignant/non-malignant cell
lines derived from human breast tissue (Hs 578T/Hs 578Bst), with statistically
greater growth inhibition demonstrated in transformed cells (Hs 578T) compared
with normal cells (Hs 578Bst) in response to both 1 and 2 mg ECM protein/ml. A
PCR array focused on death receptor pathways showed significant up-regulation
of CASP8, BID, and TRAF2 in transformed cells compared with normal cells in
response to 2 mg/ml ECM treatment. Several decoy receptor genes (TNFRSF10C, TNFRSF6B,
TNFRSF10D) were also down-regulated in transformed cells compared to normal
cells following treatment with 2 mg/ml ECM.
Henning 202, Thursday 14:00; Chair Ramon Bonfil;
Elasmobranch Ecology 1.
Bonfil, Ramon (Bronx High School of Science); O'Brien, Shannon
(University of Washington, Canada)
First Adult Female White Shark is Tracked Using
Real-Time Satellite Tags in Guadalupe Island, Mexico
Despite
recent advances in our understanding of the spatial behavior of great white
sharks, Carcharodon carcharias, real-time tracks of their movements including
oceanic migrations remain rare. Due to the difficulty and risk of deploying
real-time satellite tags on large great white sharks available data is
restricted to juveniles and one single mature male. Here, we report on the
first ever adult female great white shark tracked with a real-time satellite
tag. A 5.1 m total length female great white shark was tagged with a SPOT tag
in Guadalupe Island, Baja California, Mexico on October 16, 2006 and tracked
intermittently for a total of 288 days and 7,100 km as she traveled in a large
area of the North East Pacific Ocean. The female great white shark remained in
the vicinity of the NE coast of Guadalupe Island moving between the east and
west coasts for the next three and a half months; a preference for the north
east coast was suggested by the data. The shark left Guadalupe Island at the
beginning of February on a ca. 3,900 km westward migration. The route followed
by the shark showed remarkable directional movement to a distinct region 790 km
north-northeast of the Hawaiian Islands. During the next four months the shark
roamed in this area (ca. 680 km wide) following an irregular search-like
pattern. This area is previously unknown as a point of interest for great white
sharks in North East Pacific and different from the previously reported white shark
caf. Temperature data were intermittently transmitted by the tag and are also
presented. This study shows that real-time satellite tags provide unique and
important information for studying the spatial dynamics of great white sharks
and suggests that white sharks have remarkable navigation abilities and
confirms that not all adult great white sharks in the NE Pacific make use of
the 'White Shark Caf'.
Cartamil, Daniel (Scripps Institution of
Oceanography); Kohin, Suzanne (Southwest Fisheries Science Center);
Sosa-Nishizaki, Oscar; Santana, Omar; Olvera, Miguel (CICESE); Graham, Jeffrey
(Scripps Institution of Oceanography)
Satellite tagging of juvenile thresher sharks
(Alopias vulpinus) in the Southern California Bight
The common thresher shark is a large, wide-ranging
coastalpelagic species. In the eastern Pacific, it ranges from Baja California,
Mexico to British Columbia, Canada. Throughout its range it is harvested
commercially, and it constitutes the largest shark fishery in California
waters. Nevertheless, many aspects of its biology are poorly known,
particularly as regards early life history. In the present study, juvenile
thresher sharks (i.e., fork length < 120 cm) were tagged with pop-up
satellite archival tags (Microwave Telemetry X-tags) to investigate their
long-term movement patterns, habitat preferences, and geographic range. All
sharks were tagged in southern California waters. Tag deployments ranged from
three to six months, and tags archived light level, depth and temperature
information. In total, data were successfully acquired from 23 juvenile
threshers; eight tags were physically retrieved and produced high resolution
archival data sets. 89% of pop-off locations were over the continental shelf.
The furthest southward movement was to Bahia Sebastian Vizcaino, Baja
California, Mexico, and the furthest northward movement offshore of Morro Bay
California. Juvenile thresher sharks primarily inhabited the upper 60 m of the
water column, and showed a strong diel depth distribution, with significantly
greater depths by day. Results indicate that the nursery area of the common
thresher in the eastern Pacific consists mainly of continental shelf waters from
central Baja California, Mexico to central California, USA. In Mexican waters,
juvenile threshers are harvested by the inshore artisanal gillnet fishery.
McPherson, Diana (FIN Photography); Blaiyok,
Kautchang (N/A, Koror, Republic of Palau); Masse, Bruce (ENV-ES Enviornmental
Stewadrship Group, Los Alamos, NM, United States); Helfman, Gene (Univ of
Georgia, Lopez Island, WA, United States)
Large jacks attack and kill Blacktip Reef Sharks
Adult sharks have few natural enemies aside from other
sharks. Documented attacks by bony fishes are exceedingly rare. We report
several instances of highly aggressive, fatal, non-consumptive attacks on
Blacktip Reef Sharks (Carcharhinus melanopterus) by Giant Trevally (Caranx
ignobilis). Our direct observations and informants
reports suggest that large Giant Trevally and other carangids pursue and ram sharks at several Indo-Pacific locales. Carangids head-butt sharks
behind the gills and above the pectoral fins, causing blood to stream from the
gill region. Attacks continue until a shark is immobilized, despite obvious
injury to the head of the trevally. An attacking carangid continually
outmaneuvers its victim, restricts its escape efforts, and thwarts apparent
attempts by other sharks to defend an individual under attack. Post-mortem
examination of sharks indicates damage to several internal organs. These
attacks differ from oft-reported incidents of mobbing. We seek information on
similar interactions to determine if this turning of the tables is a common
phenomenon.
Kessel, Steven (University of Windsor); Gruber, Samuel (Bimini
Biological Field Station Foundation, Miami, FL, United States); Franks, Bryan
(Rollins College, Winter Park, FL, United States); Gedamke, Todd (National
Marine Fisheries Service, Miami, FL, United States); Chapman, Demian (Stony
Brook University, Stony Brook, NY, United States)
"Acoustic fishing" - filling the gaps
in acoustic coverage
Acoustic monitors have been used for many years to study
various aspects marine organism life-history, including residence, movement and
migration. Study species are issued with an acoustic transmitter and an array
of acoustic monitors is established in their suspected habitat/home-range. The
biggest shortfall of this system is that data can only be collect when the
study animals are within acoustic range of a monitor. Without using additional
techniques you cannot conclusively determine where they are the rest of the
time. In Jupiter, Florida, we have been using an array of Vemco VR2W monitors
to track lemon sharks (Negaprion brevirostris) since 2007. Monitor placements
were based either on diver reports or best guesses of where the lemon sharks
may spend their time. Other areas the animals use, but not covered by reports
or predictions, would not be revealed under the normal use of this technology.
To overcome this shortfall we employed a new technique labeled acoustic
fishing. Acoustic fishing is the act of moving a monitor, or
several monitors, through the marine environment to search for acoustically
tagged animals. The location of detections can later be extrapolated by
matching the time and date of the detection to the locations recorded by the
associated GPS logger. We have employed acoustic fishing in two different
formats; 1) a monitor hung over the side of the vessel whist hook and line
fishing for lemon sharks. This not only has the potential to identify new areas
of habitat use, but also tells us if any (and which) previously acoustically
tagged sharks were in the vicinity of our fishing efforts but not captured. 2)
We conducted focused acoustic fishing trips by drifting six monitors
perpendicular to shore, providing a more structured method for identifying new
areas of use within the study region. Acoustic fishing revealed up to 18
acoustically tagged sharks in the fishing area without a single re-capture,
indicating sharks may be avoiding the fishing gear after their initial capture
event. Focused acoustic fishing
trips supported theories of seasonal lemon shark presence in the region and
also provided additional data for other research projects using acoustic
telemetry. Acoustic fishing is a cost effect method for revealing new locations
used by the study species and a good tool for identifying potential new sites
for fixed monitor deployments.
Jacoby, David (Marine Biological Association of the UK); Brooks,
Edward (Cape Eleuthera Institute, Bahamas, Canada); Croft, Darren (Centre for
Research in Animal Behaviour, Exeter, United Kingdom); Sims, David (Marine
Biological Association of the UK, Plymouth, United Kingdom)
Developing a deeper understanding of shark
movements and spatial dynamics through novel application of network analyses
Understanding how and why sharks move within their
environment is fundamental for the effective management and conservation of
many threatened elasmobranch species. With site fidelity and home ranging
behaviour common in sharks, there is a need to determine how fine-scale space
use changes with ontogeny, sex, phenotype and a variety of abiotic variables.
For some time, passive acoustic telemetry techniques employing static arrays
have been used to gather discrete packets of data pertaining to the presence or
absence of individually tagged sharks at known receiver locations. A major
limitation of current approaches for analysing these data is that they rarely
account for the interconnectivity of these locations as the sharks move freely
between them. As a result, traditional analyses do not integrate graphically or
statistically a temporal component to spatial changes. Hence, the
spatio-temporal structure of movements and habitat use is often hard to extract
and compare for large numbers of individuals using the same habitats. Here we
present the novel application of network theory to passive acoustic telemetry
data which describe the movements of two very distinct species, the Caribbean
reef shark (Carcharhinus perezi) and the small spotted catshark ( Scyliorhinus
canicula ). This approach treats specific locations as network nodes and the
movement of sharks between receivers as network edges. Some descriptive and
quantitative analyses that are possible with this new technique are highlighted
and assessed in relation to their application to enhanced management and
conservation strategies.
Larson, Shawn (Seattle Aquarium); Griffing, Denise; Hollander,
Joel; Christiansen, Jeff (Seattle Aquarium)
Summary of sixgill shark tagging and abundance
estimates from 2003-2009 in the urban inland waters of Elliott Bay, Seattle
Anecdotal reports of diver-shark encounters in the Pacific
Northwest stimulated interest in the normally deep-dwelling, poorly studied
bluntnose sixgill shark (Hexanchus griseus) and the reason for its presence in
the shallow waters of the Salish Sea. Capture/Mark/ Recapture techniques were
used to identify individual sharks for population structure and movement
pattern analysis. Temporal changes in relative abundance in Puget Sound are
reported from a controlled study site (2003-2005) at the Seattle Aquarium and
citizen sighting/encounter reports (2000-2009). At the Seattle Aquarium study
site on Elliott Bay, Seattle, 45 sixgills were tagged with modified Floy visual
marker tags, along with an estimated 116 additional untagged sixgills observed
via video camera. The majority of sixgills observed were adolescents, and they
were found to be significantly more abundant in the summer months. Observations
of sixgills peaked in 2003-2005 and declined to very few observations from
2006-2009. While conservation measures have been enacted in Washington and
British Columbia waters, additional measures may be necessary as large,
long-lived sharks like sixgills are thought to be unable to sustain
exploitation.
Ferreira, Luciana (UFRPE); Afonso, Andr (UFRPE,
Recife, Brazil); Castilho, Pedro (UFRPE, Serra Talhada, Brazil); Hazin, Fbio
(UFRPE, Recife, Brazil)
Habitat use of the nurse shark, Ginglymostoma
cirratum, off Recife, Northeast Brazil: a combined survey with longline and
acoustic telemetry
Despite the high abundance of nurse sharks Ginglymostomas
cirratum in shallow waters, knowledge on its ecology is still rather limited,
with most studies restricted to the Caribbean and Florida coast. This study
presents results on the relative abundance, sex ratio, size distribution,
seasonal fluctuations and residency of the nurse shark, off Recife, northeast
Brazil. Nurse sharks comprised 13.3% of the total catch of 1033 bottom longline
sets, done from 2004 to 2011, and ranged in size from 107 to 300 cm TL. 98
sharks were tagged with an 8% recapture rate. The overall sex ratio for nurse
sharks was 1.3♀:1♂, however, it showed a strong variation
throughout the year. The monthly CPUE of male nurse sharks showed a somewhat
more seasonal trend than females. Male CPUE tended to be lower (0.02) from
October to April (except for December). Although female CPUE oscillated within
a range similar to that of males, it showed no clear seasonal pattern. Of 8
acoustically tagged sharks, 6 were detected by the array of acoustic receivers.
Most detection of males were recorded during the first semester of the year,
peaking in February and March with zero detection from May to September.
Females, in turn, were detected throughout the year, although most detection
happened in the second semester, peaking in September. The results indicate
that nurse sharks have a year-round occurrence in the study area and remain in
the monitored area for variable periods of time. The strong seasonal shifts in
the sex ratio of catches and the patterns revealed by the acoustic detections
also suggest a possible difference in habitat usage or
in seasonal movements between sexes, which hadnt been described so far for the
Brazilian coast and may have serious implications for the management and
conservation of nurse sharks at Northeast Brazil.
Kuhnz, Linda (MBARI); Bizzarro, Joseph (University of
Washington, Seattle, United States); David, Ebert (Pacific Shark Research
Center Moss Landing Marine Laboratories, Moss Landing, United States)
In-situ Observation of Deep-living Skates in the
Eastern North Pacific
We report on in-situ observations of more than 500
deep-sea skates from between 600 and 3,322 m among a variety of locations,
including: the Pacific Northwest, northern California, the Monterey Canyon,
central California seamounts, southern California basins, and the Gulf of
California. Physical information (i.e., geographic location, depth, habitat
associations), and biological data (i.e., species, sex, maturity, behavior)
were evaluated. Multiple skates of an unknown species were observed below 3,000
m and represent some of the deepest visual observations of skates. Several
additional unidentified species were observed. This study also extends the
maximum depth range of Amblyraja badia, Bathyraja abyssicola, and B.
spinosissima.
Farrugia, Thomas (University of Alaska Fairbanks);
Seitz, Andrew (University of Alaska Fairbanks, Fairbanks, AK, United States)
Movement patterns of skates in the Gulf of
Alaska and implications for the management of a skate fishery
Skates are in growing demand worldwide, specifically in
European and Asian markets. As part of supplying this demand, the U.S. landings
of skates in 2008, mainly from the Atlantic Ocean, was estimated at 65 million
pounds, worth US$11 million. However, several Atlantic Ocean skate stocks are
declining. In contrast, Alaska has relatively healthy skate stocks but skates
can only be retained as non-target catch in federal and state waters of Alaska.
Big skates (Raja binoculata) are the most frequently landed skate in the Gulf
of Alaska and are managed by two management agencies, that each divide the
skate non-target catch quota into multiple management areas and assume that big
skates do not move among these areas. If a directed skate fishery is to be
developed, more ecological data such as movement patterns and habitat use need
to be explored. We deployed pop-up archival transmitting (PAT) tags on seven
big skates in Prince William Sound, Alaska in July 2011 and set them to pop up
in May and June 2012. This was the first instance of an electronic tag being
deployed on any skate species in the Pacific Ocean and provided novel data on
the movement patterns, temperature and depth utilization of big skates. It also
provided a fishery-independent estimate of the connectivity of big skates
between management areas. Ecological data such as these are crucial when
managing a novel fishery, and are necessary when employing increasingly popular
ecosystem-based management.
Figueroa, Daniel (Universidad Nacional de Mar del
Plata); Barbini, Santiago; scenna, lorena; Delpiani, Gabriela; Spath, Cecilia
(UNMdP, CONICET, Mar del Plata, Argentina); Belleggia, Mauro (UNMdP, INIDEP,
CONICET, Mar del Plata, Argentina)
Antarctic history of the family Rajidae
Skates are a group of fish of an ancient lineage, a high
specific diversity, a cosmopolitan distribution and a non-migratory mode of
life, given that they are benthic fishes all along their ontogeny, which starts
from the embryo stage in ovarian capsules with adhesive filaments. They
constitute a valuable analytical tool when associated to geological processes.
In modern Antarctica, the family Rajidae is represented by two cosmopolitan
genera, Amblyraja with two species, and the most speciose genus in the world,
Bathyraja, with approximately seven species. Climate of the late Cretaceous and
early Tertiary times in the Antarctica was much more temperate than nowadays.
Of coastal waters and extensive shelves, fossil records reveal the presence of
siluriform, gadiform, cupleoid, trichiurid and labrid fishes, all typical
modern exponents of the Buenos Aires District north of the Argentine
continental shelf. This southwestern Atlantic sector shows at world level one
of the oddest overlapping of endemic genera of skates. The fossil rays teeth
found in the Eocene La Meseta Formation would probably belong to this group of
skates instead of to Bathyraja and Amblyraja, as stated by some other authors.
Both these two genera of rays accompanied by two families of bony fish
(Zoarcidae and Liparidae), of sympatric distribution with these genera of
skates in the Northern Hemisphere, probably joined the opening of Drake Passage
in the late Tertiary, together with the incoming of the Pacific deep cold
waters.
Chan Centre, Friday 8:15 AM, Plenary 2: AES Invited
Speaker and WCH7 Plenary Address
Ferry, Lara (Arizona State University West);
Elasmobranchs in Biological Research
Elasmobranchs get a lot of attention both within and
beyond the scientific realm due to their fascinating, and sometimes terrifying,
habits. This high profile has, in many cases, overshadowed some of the most
amazing insights that have come from the study of this group. Such studies have
taught us not only about the cartilaginous fishes, but also have given us novel
insights into the most important and difficult to penetrate areas of biology.
These advances could not have been made with the use of any other study system.
This presentation will highlight several recent advances that should serve as
inspiration for biologists interested in exploring fundamental biological
questions. Among the exemplar projects that I will highlight are what shark and
ray brains have to tell us about the evolution and function central nervous
systems, what can be learned of sensory hierarchy from blacktip sharks, how
stingrays crushing hard prey has inspired new biomaterials, and how the shark
immune system and is teaching us about our inherent ability to recognize self
and non-self.
Henning 201, Friday, 9 AM; Chair Steve Kajura; AES Gruber
Award 1.
Hollensead, Lisa (Florida State University);
Carlson, John; Bethea, Dana (NOAA NMFS Panama City Laboratory, Panama City, FL,
United States); Grubbs, R. Dean (Florida State Coast Marine Laboratory, St.
Teresa, FL, United States)
Monitoring movement patterns of juvenile
smalltooth sawfish (Pristis pectinata) using acoustic monitoring and tracking
in a nursery habitat in southwest Florida
Historically, the U.S. range of smalltooth sawfish
stretched from North Carolina to Texas including the Gulf of Mexico. Due to
fisheries bycatch, habitat loss, and a low productivity, the US population has
declined leading to their inclusion on the U.S. Endangered Species Act in 2003.
Necessary to their recovery is a description of critical habitat, mandated in
the Smalltooth Sawfish Recovery Plan. Using passive acoustic telemetry and
active tracking, precise delineation of smalltooth sawfish activity space and
patterns of habitat use can be determined. Juvenile smalltooth sawfish less
than 1.5 meter total length were fitted with two Vemco acoustic tags. An R
coded tag was used to passively monitor movements with an array of 32 VR2w
receivers in Everglades National Park and 3 VR2w receivers in Faka Union Bay,
Florida. A continuous tag was used for active tracking using a VR100
hydrophone. In 2011, 24 animals were captured and fitted with acoustic
transmitters. Residency time was found to be longer than previously
hypothesized with animals remaining in the system through out the winter
months. Seven animals were
actively tracked for a minimum of 4 hours and a maximum of 32 hours. Benthic
samples and mangrove habitat properties were measured in an effort to create a
habitat selectivity model. For the
benthic samples, percent sand, silt, clay and organic content were measured.
Mangrove habitat was measured throughout the two study sites and was
categorized by branch overhang, prop root density, and rhizome density. Other
abiotic factors (temp, depth etc) were also measured.
Knuckey, James (Moss Landing Marine Laboratories); Clerkin, Paul;
Ebert, David (Moss Landing Marine Laboratories)
Biodiversity and Conservation of Western Indian
Ocean Chondrichthyans
The biodiversity of the Western Indian Ocean
chondrichthyans is relatively unknown compared to other better studied regions,
such as the western North Pacific, North Atlantic, and Indo-Pacific regions.
The Western Indian Ocean has at least 279 species overall, with 152 shark
species, 120 batoid species, and 8 chimaera species. This number comprises
23.3% of the approximately 1,200 valid species of chondrichthyans. The sharks
are more diverse than the batoids, but this is most likely due to more
attention having been paid to the sharks than the batoids in this region. The
Carharhiniformes (82 species), Myliobatiformes (46 species), Squaliformes (36
species), and Rajiformes (29 species) are the most dominant groups in terms of
species-richness within this region.
The close proximity of the Western Indian Ocean to the Indo-Pacific,
which has been shown to be a center of origin for the marine tropics, may
explain the relatively high number of species. Most chondrichthyan species accounted for in this study are
coastal species, which may explain why some of the families have lower numbers
than reported in other regions, such as the Rajiformes; a species group known
to generally occur in deeper waters of the tropics. Islands and island chains
show a high degree of endemism compared to the continental shelf and upper
slope habitats. The majority of species found in this region are listed as Data
Deficient (100 species), Near Threatened (54 species), or Vulnerable (51
species) on the IUCN Red List. Enhanced identification of Western Indian Ocean
chondrichthyans is crucial for developing improved management and conservation
policies for this group.
Geraghty, Pascal (Macquarie University); Macbeth,
William (NSW Department of Primary Industries, Sydney, N, Australia);
Williamson, Jane (Macquarie University, Sydney, N, Australia); Wintner, Sabine
(KwaZulu-Natal Sharks Board, Umhlanga, South Africa); Johnson, Grant
(Department of Resources, Darwin, NT, Australia); Ovenden, Jennifer (Molecular
Fisheries Laboratory, Brisbane, Q, Australia); Gillings, Michael (Macquarie
University, Sydney, N, Australia)
Contrasting population structures suggest
different evolutionary histories for three large, coastal shark species off
eastern Australia
Commercial catches of large sharks in eastern Australian
waters are dominated by three species: Carcharhinus plumbeus (sandbar shark),
C. obscurus (dusky shark) and C. brevipinna (spinner shark). Life-history
traits render these species highly vulnerable to over-exploitation. Despite
significant management and conservation concerns currently surrounding the
targeting of these sharks, very little is known of their biology in local
waters. This study examined the genetic diversity and population structure of
these three species off the east coast of Australia, as well as over a broader
spatial scale for C. brevipinna, using a mitochondrial gene marker [857 base
pairs of NADH dehydrogenase subunit 4 (ND4)]. Sequence data for 442 C.
plumbeus, 428 C. obscurus and 430 C. brevipinna revealed contrasting haplotype
networks, suggesting that present-day populations of these species off eastern
Australia have been shaped by dramatically different evolutionary histories.
Spatial genetic-homogeneity was observed for both C. plumbeus and C. obscurus
populations despite the presence of distinct clades. We hypothesise that
discrete, closely-related lineages, having evolved in isolation following a
temporary barrier to gene-flow within a previously mixed population, have
subsequently become re-integrated within the study area. In contrast, C.
brevipinna appears to have undergone a significant population expansion event,
and exhibits evidence for restricted maternal gene-flow over both intermediate
and broad spatial scales. Such differing population structures suggest that
sustainable management requires assessment at a species level.
Giresi, Melissa (Texas A&M University);
Renshaw, Mark; Portnoy, David; Gold, John (Texas A&M University)
Molecular Identification of Smooth-hound Sharks
in the Gulf of Mexico
The morphological similarity of sharks in the family
Triakidae (the smooth-hound sharks) has led to considerable taxonomic confusion
and problems in species identification. The lack of clear and accurate
identification methods for smooth-hound sharks prevents reliable
species-specific landing estimates and obscures the ability to accurately
assess species composition. Within the Gulf of Mexico, there are four nominal
species in the genus Mustelus: M. canis, M. higmani, M. norrisi, and M.
sinusmexicanus. While there are a multitude of studies that utilize
microsatellites to elucidate population structure of a single species, the fact
that microsatellites often amplify in closely related species is
under-utilized. In this study, multiplex microsatellite PCR reactions are
presented, which can be utilized to reliably distinguish between the four
Mustelus species inhabiting the Gulf of Mexico. Elucidating the spatial
distribution patterns of smooth-hound shark resources in the Gulf of Mexico is
a critical first step to species management.
Boswell, Leigh Ann (Department of Zoology,
University of Hawai'i / Hawai'i Institute of Marine Biology); Tricas, Timothy
(Department of Zoology, University of Hawai'i / Hawai'i Institute of Marine
Biology, Honolulu, HI, United States)
Identity and density of olfactory receptor
neurons in the nasal epithelium of juvenile hammerhead sharks, Sphyrna lewini
Aquatic toxicants can damage the fish peripheral olfactory
system and cause deficits in fitness-related behaviors such as feeding,
predator avoidance, and mate recognition. However, the response of the shark
olfactory system to toxicants, and for many species the type, density, and
total number of olfactory receptor neurons (ORNs) involved in odorant
detection, are still unclear. The olfactory rosette organ was examined by
histology in the juvenile scalloped hammerhead, Sphyrna lewini, to identify and
quantify the ORNs present in their chemosensory epithelium. Microvillar ORNs
(mORN) and crypt neurons (CN) occur in all horizontal sections of the rosette.
Cell bodies of mORNs have a circular shape and mean diameter of 7.2 0.5
μm, highest densities in the mid regions of the sensory epithelium, and an
average density of 23,552 8,198 cells/mm2. Cell bodies of CNs have a smaller
kidney-shape and mean diameter of 5.3 0.7 μm, and lower density of 523
944 cells/mm2. The primary lamellae epithelial surface area of both olfactory
organs is estimated at 6,010 mm 2 for a 56.1 cm TL juvenile. These combined
estimates indicate that a 56.1 cm TL juvenile S. lewini has a putative total of
at least 142,000,000 mORNs and 3,00,000 CNs, and is higher when secondary
lamellae and surface area of adult sharks are considered. The total number of
olfactory receptors ranges from 3-7 million in teleosts, 2.5 million in humans,
and 220 million to 2 billion in canines. Thus this first estimate of total
olfactory receptors for S. lewini is in great excess to that reported for other
fishes examined so far and is closer to that of canines. These results provide
only the second example of a shark species containing two ORNs in the olfactory
organ and give the first quantitative densities of each ORN type throughout the
primary lamellae of the peripheral olfactory system. This research provides the
quantification of ORNs necessary to determine epithelial degradation after
toxicant exposure based on changes in ORN densities.
Bedore, Christine (Florida Atlantic University);
Loew, Ellis (Cornell University, Ithaca, NY, United States); Kajiura, Stephen
(Florida Atlantic University, Boca Raton, FL, United States)
Can batoids see in color? Multiple cones types
are present in two batoid elasmobranchs
Elasmobranch fishes have adapted to nearly every marine
environment, many of which are spectrally distinct. Whereas the deep sea is
light limited and consists of almost exclusively blue wavelengths, coral reefs
are among the most colorful environments on the planet. Elasmobranchs have
evolved optimal visual capabilities for their diverse spectral environments.
The cownose ray (Rhinoptera bonasus) and he yellow stingray (Urobatis
jamaicensis) are two batoid elasmobranchs that inhabit diverse spectral
habitats which likely reflect their potential for color discrimination. The
cownose ray inhabits turbid, coastal waters typically dominated by green
wavelengths, whereas the yellow stingray inhabits coral reef environments that
are blue dominated, but spectrally diverse. Therefore, the yellow stingray is
more likely to be capable of color vision than the cownose ray. Additionally,
ultraviolet (UV) light is present in both environments, so it is possible that
one or both species possess the ability to see UV wavelengths. The maximum
absorbance of photoreceptors from two individuals of each species was analyzed
using micro–spectrophotometry (MSP). Both rays possessed rod-dominated
retinas with a λ max near 500nm (green), but differed in the number of
photo pigments. The yellow stingray had three distinct cone types with maximal
absorbance in blue (475nm), green (533nm), and yellow (562nm) regions of the
visible spectrum whereas the cownose ray had two distinct cone types with
maximal absorbance in blue (470nm) and yellow (551) regions. Neither species
showed evidence for UV sensitivity in MSP analysis. The light filtering effects
of the ocular media (cornea and lens) were quantified by measuring transmitted
wavelengths of broad-spectrum white light (400-800nm) and UV rich light
(<400nm). Both rays transmitted visible light through the ocular media,
however, most UV light was absorbed by the lens in both species. Cownose rays
blocked transmission of all wavelengths below 400nm, whereas yellow stingrays
transmitted some UV wavelengths, but absorbed all wavelengths below 385nm.
Although both rays possessed multiple cone types, it is likely that the two
cone types in the cownose ray enhance contrast detection, rather than function
for color discrimination. Conversely, the trichromatic yellow stingray likely
possesses true color vision.
Prohaska, Bianca K. (University of New England);
Tsang, Paul C.W. (University of New Hampshire); Driggers III, William B.;
Hoffmayer, Eric R. (National Marine Fisheries Service, Mississippi)
Laboratories); Sulikowski, James A. (University of New England)
Potential Utilization of Steroid Hormones
Extracted from the Skeletal Muscle Tissue of the Spiny Dogfish (Squalus acanthias),
the Little Skate (Leucoraja erinacea), the Atlantic Sharpnose Shark
(Rhizoprionodon terraenovae), and the Atlantic Stingray (Dasyatis Sabina)
Currently, circulating levels of plasma steroid hormones
have been used as a non-lethal method to determine reproductive maturity and
reproductive cycles in elasmobranchs.
However, this method can prove problematic to perform on large and/or
endangered species, because of difficulties involved with specimen handling.
These constraints make it imperative for new techniques to be developed for
studying the reproductive biology of elasmobranchs. Previous work conducted on
other vertebrates has shown that steroid hormones can be successfully extracted
from muscle tissue. The process of collecting muscle tissue samples is quick,
minimally invasive, and may be conducted without removing the animal from the
water, facilitating its use on larger, and/or endangered species of
elasmobranchs. The focus of this presentation will be the development of a
valid method for extracting steroid hormones from the skeletal muscle tissue of
the lecithotrophic aplacental viviparous spiny dogfish, the oviparous little
skate, the placental viviparous Atlantic Sharpnose shark, and the matrotrophic
aplacental Atlantic stingray. For each species 40 females are currently being
collected from the Gulf of Maine, and the Gulf of Mexico and will consist of 10
immature individuals, to act as control replicates, 10 early-gestation
individuals, 10 mid-gestation individuals, and 10 near parturition individuals.
Sample collections of spiny dogfish, little skate, Atlantic sharpnose sharks,
and Atlantic stingray began in October 2010, and the remaining samples will be
collected throughout the following year. To verify the use of this tissue for
reproductive analysis, steroid hormone levels extracted from skeletal muscle
tissue will be compared to the concentrations and patterns of those same
steroid hormones extracted from plasma, via radioimmunoassay. Preliminarily,
the results suggest that a trend exists between the concentrations of steroid
hormone levels in the plasma to those in the skeletal muscle tissue.
Speaks, Justin (University of West Florida);
Photoperiod and Temperature Effects on Steroid
Hormone Production and Dental Plasticity in the Male Atlantic Stingray,
Dasyatis sabina
Photoperiod and temperature are recognized as two of the
most important environmental cues in temperate freshwater and marine
ecosystems. While manipulations of environmental factors, and their relative
control over reproductive physiology, have been studied in many teleost fishes,
elasmobranchs are not as well represented. The Atlantic stingray has a
protracted and well-defined mating season beginning in early Autumn and ending
in late Spring, and can be observed in males not only by increases of
androgens, but by changes in dentition. In this experiment the proximate
affects of temperature and photoperiod on dentition and reproductive hormones
were quantified in the Atlantic Stingray. It is proposed that if photoperiod
and temperature are the dominant proximate factors for reproduction in this
species, they should directly activate androgen production. The increase in androgens following
gonadal recrudescence should, in turn, trigger the dental modification seen in
mating male stingrays. Results indicate that temperature is a strong proximate
cue for onset of testosterone production in laboratory studies, however wild
samples indicated photoperiod plays an important role as well. Laboratory
animals showed the highest hormone response in treatments that simulated both
decreasing daylength and temperatures. High temperatures in the laboratory
showed a distinct inhibitory effect on testosterone production. Dental
morphology displayed a trend of increasing percentage of samples with cuspidate
dentition as the wild population moved into the breeding season, following a
period of increased androgen production. Laboratory samples also responded in a
similar fashion, although not as clearly as the wild population. Samples with low
testosterone levels over the course of the experiment showed a higher
percentage of molariform dentition, while those exhibiting increased
testosterone had a higher percentage of cuspidate and transitioning dentition.
This study further elucidates the influence of photoperiod and temperature on
gonadal recrudescence in an elasmobranch. It is the first experiment to examine
associations between circulating hormone levels and changes in dental
morphology, a secondary sex characteristic that has received little attention.
This research should provide an impetus to develop new lines of investigation
into the discrete physiological mechanisms that control reproduction in
elasmobranch fishes.
Ambrosino, Christine M. (Hawaii Institute of Marine
Biology); Tricas, Timothy C. (University of Hawaii at Manoa)
Ampullary structure and receptor field dependent
orientation in the scalloped hammerhead shark, Sphyrna lewini
Elasmobranch fishes use their ampullary electrosense to
detect bioelectric dipole fields produced by hidden prey or potential mates.
Gel-filled canals project from the ampullary subgroups and have unique
somatotopic and spatial distributions. We tested the functional subunit
hypothesis that predicts that different orientation behaviors are controlled by
different ampullary groups. Premanipulation orientation behavior of juvenile
Sphyrna lewini to electric dipole stimuli was recorded on video. Ampullary
pores of two subgroups, the buccal (BUC) and superficial ophthalmic anterior
(SOa), were then inactivated by application of a non-conductive jelly on the
skin and tested again to observe changes in orientation behavior. This
non-invasive jelly blockade of the electroreceptor system affected the sharks
ability to orient to an electric field, but
had no effect on feeding and swimming behavior. Orientation frequency decreased
after subgroup inactivation in both BUC and SOa treatments. However, average
orientation distance did not differ among the treatment groups. In
unmanipulated sharks, the spiral and turn approach behaviors were most
frequent. Sharks with the BUC pores inactivated showed decreased accuracy in
spiral behavior. This indicates the animals were unable to accurately follow
the dipole field lines to locate the simulated prey source. Sharks with the SOa
pores inactivated demonstrated impaired initial field detection through
increased overshoot behavior. These responses to the blockade of ampullary
subgroups support the functional subunit hypothesis and demonstrate that the
ampullary subgroups may play different roles in the electro-orientation
behavior of sharks. Also, as the BUC and SOa treated sharks often missed biting
in the proper target area, accurate orientation paths may require information
summation from all ampullary subgroups.
Gardiner, Jayne (Mote Marine Laboratory); Atema,
Jelle (Boston University, Boston, MA, United States); Hueter, Robert (Mote
Marine Laboratory, Sarasota, FL, United States); Motta, Philip (University of
South Florida, Tampa, FL, United States)
Multimodal Integration and Sensory Plasticity in
Shark Feeding Behavior
Multimodal sensory
input directs simple and complex behaviors in animals, but most research to date has focused on
individual senses. We investigated three species of sharks from different ecological niches:
benthic, suction-feeding nurse sharks hunt
nocturnally for fish; ram-biting bonnethead scoop crustaceans off the bottom of
seagrass beds; and ram-feeding blacktip sharks rapidly chase down midwater teleost prey. We
deprived animals of
information from the
senses (olfaction, vision, mechanoreception, and electroreception), alone and in combination, to elucidate
their complementary
and alternative
roles in detecting, tracking, orienting
to, striking at, and capturing live prey.
This work revealed similarities and differences among species in the use of the senses for
particular behaviors. In
most cases,
multiple senses can be used for the same behavioral task. Thus, sharks are capable of successfully
capturing prey, even when the optimal sensory cues are unavailable, by switching to
alternative sensory modalities. This indicates that feeding behavior is plastic. Nurse sharks rely on olfaction for detection, and track
using olfaction combined with vision, the lateral line, or touch. They orient to prey using the
lateral line, vision, or
electroreception,
but will not ingest food if olfaction is blocked. Capture is mediated by electrosensory or
tactile cues. Bonnetheads normally detect prey using olfaction, use olfaction combined with vision or the
lateral line to
track, vision to
line up a strike, and electroreception for capture. They can detect, orient, and strike
visually in the absence of olfactory cues. Blacktip sharks can also detect prey using
olfaction or vision. They use olfaction combined with vision or the lateral line to track. Long-distance
orientation and
striking is
visually mediated but strikes are fine-tuned just prior to capture using the lateral line.
Short-range orientation and striking can occur in the absence of vision using lateral line cues.
Capture is mediated by electrosensory or tactile cues. The blacktip shark shows the greatest amount
of modulation in
capture
kinematics, followed by the nurse shark. Little to no modulation was observed in the bonnethead. These
results suggest that capture is less plastic in elasmobranchs than in bony fishes and that modulatory
ability varies by
species.
Henning 202, Friday 9 AM; Chair John Carson; Elasmobranch
Conservation 1.
Harrison, Lucy (IUCN Shark Specialist Group); Dulvy, Nick (IUCN
Shark Specialist Group, Burnaby, BC, Canada)
Towards a Species Conservation Strategy for
Sawfish
All seven species of sawfish are globally listed as
Critically Endangered by the IUCN Red List and are listed on CITES; both the
smalltooth and largetooth sawfishes are listed on the US Endangered Species
Act. Sawfishes were formerly widespread in tropical and subtropical coastal
waters, with some species extending into freshwater. However, their
distribution is now severely fragmented, and some sawfish are thought to be
locally extinct from large parts of their former range, for example in the Gulf
of Mexico, West Africa and the Indo-Pacific. Because of this, and their
k-selected life history, there is a very real risk that this ecologically
unique and evolutionarily distinct lineage will vanish in our lifetime due to
an intrinsic vulnerability to extinction. The IUCN Shark Specialist Group
develops Species Conservation Strategies (SCS) for species that would benefit
from immediate conservation action, i.e. sawfishes. Here, we describe the
Species Conservation Strategy process and review the current status of
sawfishes, summarize current conservation activities and provide priority
recommendations for further action.
Carlson, John (NOAA NMFS Panama City Laboratory); Smith, Kelcee
(National Marine Fisheries Service, Panama City, United States); Norton,
Shelley (National Marine Fisheries Service, Saint Petersburg, United States);
Simpfendorfer, Colin (James Cook University, Townsville, Q, Australia)
Extinction risk and viability of sawfish
populations
Sawfish (Family Pristidae) populations have been declining
worldwide and currently are among the most endangered marine fishes. Data from
multiple sources indicates many populations have undergone significant
population declines and severe fragmentation. As such, the International Union
for the Conservation of Nature (IUCN)
lists all species of sawfish as ―Critically Endangered‖ on the IUCN Red List and the United States lists the US distinct population of
smalltooth sawfish and globally the largetooth sawfish as Endangered under the
Endangered Species Act. Despite these listings, there is little investigation
on the existing populations in terms of their current risk of extinction, and
potential viability and recovery. Given the lack of data for many populations,
we determined the probability that local scale extinction have occurred using a
time series of incidental observations, such as surveys, museum collections and
records from the public. For
existing populations, we applied a sensitivity analyses to suggest minimum
probability levels for declaring a species to be in danger of local extinction.
For all species examined, the highest probability of localized extinction
occurred in West Africa and Central America with the lowest probability
determined for Australia and the United States. Recognizing the model does not
take into account important biological information (e.g. population increase
rates), we determined quasi-extinction risks in a population viability model and
found all populations had the potential to increase given fishing mortalities
below 20%.
Gallagher, Austin (University of Miami);
Evolved for Extinction? The rise and fall of the
hammerhead sharks
The hammerhead shark is arguably one of the most recognizable
and mysterious species on the planet, a fascinating example of biodiversity and
evolution. The large hammerheads are apex predators and hold significant
ecological importance in structuring food web dynamics and function. Recent
scientific assessments of this Family of sharks suggest that they are among the
most exploited globally. To illustrate the drivers of such declines, we suggest
that all hammerhead sharks have become victims of an evolutionary trap. Evolutionary traps occur when aspects of a
species selected biology and ecology
intersect with human
disturbance factors to lead to maladaptive outcomes (i.e., mortality, fitness
loss). While these phenomena have been widely documented in terrestrial systems
and has subsequently led to increased conservation attention for certain
species, similar evidence in marine systems is lacking. We present novel
insights and quantitative data on this issue by linking biological
(life-history), evolutionary (phylogeny), physiological (high stress response),
behavioral (schooling and migrations), economic (high economic value to the
finning industry) and human/ social (irrational fear and disvalue) drivers of
an evolutionary trap specific to large hammerhead sharks. Finally, we discuss
these findings in terms of risk assessment and conservation triage.
Shivji, Mahmood (Save Our Seas Shark Center USA
and Guy Harvey Research Institute, Nova Southeastern University); Horn, Rebekah
(Save Our Seas Shark Center USA and Guy Harvey Research Institute, Nova
Southeastern University)
A meta-analysis of matrilineal population
genetic structure in fishery exploited sharks
Assessment, management and conservation of resources by
their individual populations/stocks is a central goal of fishery managers. This
goal also applies to shark fisheries, but management of sharks on a population
basis is still infrequent partly because information on their population
delineation is limited (although growing). This limitation is particularly
acute for species that have widespread distributions and constitute major
components of the global fishery catch. Contrary to expectations given the
apparent potential for long-distance movement by many large shark species,
studies that have examined their population structure are revealing notable
levels of genetic differentiation at various spatial scales. We present a first-look
meta-analysis of maternal lineage (mitochondrial DNA-based) population genetic
structure in sharks based on published and unpublished data. At the minimum,
inter-ocean basin or inter-hemispheric population differentiation based on
mitochondrial markers is present in nearly all species with global
distributions. For some species, statistically significant, matrilineal
population structure has been detected within ocean basins, and in some cases
this structure is present over relatively small geographic scales (1000-2500
km) and even continuous coastlines. Although more detailed information on shark
population structure is still required (i.e., studies with many more sampling
locations and more statistical power using more markers and/or larger sample
sizes), the growing evidence that sharks consist of genetically differentiated
populations bodes well for assessment and management of sharks on a
population-specific basis, the ability to track the population origin of shark
products in fisheries and trade for fishery law enforcement efforts, and
monitoring landings and markets to detect if certain populations in
less-regulated fisheries are being inadvertently overexploited.
Hazin, Fabio (UFRPE); Afonso, Andre (UFRPE, Recife, Brazil);
Cerqueira Ferreira, Lucianna
Shark Monitoring Program off Recife, Brazil
Shark attacks on humans have prompted the implementation
of shark control programs aiming at reducing local populations of dangerous
species using gillnets. However, shark meshing inflicts severe mortality to
both target and harmless species and produces significant ecological
disturbances. A different methodological approach to mitigate shark peril off
Recife, Brazil, combines bottom longline gear and drumline gear equipped with
circle hooks with great efficiency. Four longline sets have been systematically
conducted at two fishing sites on a weekly basis. Longlines are deployed at
about 1.5-3 km from shore, while 23 drumlines are deployed at about 0.5-1 km
from shore. This spatial arrangement aimed at intercepting approaching sharks
before they enter into the area of peril by imposing two "shields"
with decreasing fishing effort shorewardly. Following the capture of a potentially
aggressive shark, the animal is hauled into the vessel, accommodated in a wet
tank assembled on the deck, and then transported towards the continental slope
for tagging and release. A total of 1,121 individuals were caught in 280,079
baited hooks deployed between May 2004 and December 2011. The catch composition
evidenced high selectivity for sharks and comprised fish species and a few
turtles only. Eight potentially aggressive sharks were caught, corresponding to
large carcharhinids and sphyrnids. Tiger, bull, and blacktip sharks exhibited
higher catch rates in decreasing order and are believed to be responsible for
most of the attacks. The global fishing mortality was reasonably low (about
20%) and protected species such as goliath groupers, nurse sharks, and turtles
showed ~100% survival. The littoral of Recife accounts for 55 confirmed shark
attack incidents corresponding to 20 fatalities since 1992. Yet, since the
creation of the shark monitoring program of Recife, the shark attack rate
diminished about 97% while fishing operations were being conducted (W = 1108.5,
P < 0.001), with >90% of the attacks occurring when the program was
paused for funding renewal. Overall, the shark monitoring program of Recife
produced little impacts on caught species and raised essential information for
the management of sharks.
Howey-Jordan, Lucy (Microwave Telemetry, Inc.);
Brooks, Edward (Cape Eleuthera Institute, Ft. Lauderdale, United States);
Brooks, Annabelle (Cape Eleuthera Institute, Canada); Abercrombie, Debra
(Abercrombie and Fish, Canada); Williams, Sean (Stuart Cove, Canada); Jordan,
Lance (Microwave Telemetry, Inc.); Chapman, Demian (Stony Brook University)
Time well spent: Substantial use of the Bahamas
shark sanctuary by mature female oceanic whitetip sharks revealed by pop-off
satellite archival tags
Once considered among the most abundant pelagic predators,
the oceanic whitetip shark (Carcharhinus longimanus) has drastically declined
in the last few decades due to overexploitation. This species is especially
impacted in the western Atlantic Ocean, where it is currently listed as ―Critically
Endangered‖ by the International Union for the Conservation of Nature (IUCN). Cat
Island in The Commonwealth of The Bahamas is one of the few places where this
species is regularly observed. After banning longline fishing in the mid-1990s,
The Bahamas recently prohibited commercial shark fishing in its 630,000 km 2
Exclusive Economic Zone (EEZ). The goals of our study were to: 1) quantify the
time oceanic whitetips spend within this EEZ, 2) determine long-term movements
of individuals as they moved away from The Bahamas, and 3) characterize the
vertical and thermal habitat use of this understudied pelagic species. We
deployed pop-up satellite archival tags on 11 adult female sharks near Cat
Island in May 2011 as a pilot effort to achieve these goals. Another female
shark was opportunistically tagged 420 km south of Cape Hatteras, USA. Eleven
tags reported, collecting a total of 1,563 days of tracking data. Four tags
were physically recovered, adding greater resolution to the dataset –
1,146,959 depth and temperature records combined. Mean depth used by tracked
sharks was 43.9 m ( 10.34 SD) and the mean temperature encountered was 26.1 C
( 0.55 SD). The deepest dive observed was 1081.9 m and the coolest temperature
experienced was 7.75 C. Reconstructed tracks revealed that tagged individuals
moved long distances (some more than 1,000 km from tagging site) over a wide
area but spent substantial amounts of time (approximately 58 % of days tracked)
within the Bahamian EEZ. It therefore appears likely that the Bahamas longline
ban and newly implemented shark sanctuary has and may continue to provide a
significant refuge for this threatened species.
Knip, Danielle (The University of British Columbia); Heupel,
Michelle (Australian Institute of Marine Science, Townsville, Q, Australia);
Simpfendorfer, Colin (James Cook University, Townsville, Q, Australia)
Evaluating marine protected areas for the
conservation of tropical coastal sharks
Global declines in shark populations have created
uncertainty in the future status of many species and conservation efforts are
urgently needed. Marine protected areas (MPAs) are used increasingly as
conservation tools around the world, but how they benefit mobile and wide
ranging species like sharks remains unclear. To evaluate the degree of
protection MPAs may provide for sharks, we used an array of acoustic receivers
to examine the movements and spatial use of two tropical coastal species within
two MPAs in the Great Barrier Reef Marine Park, Australia. Juvenile pigeye
(Carcharhinus amboinensis) and adult spottail (Carcharhinus sorrah) sharks were
fitted with acoustic transmitters and monitored from 2009 to 2010. Both species
displayed long-term use of MPAs, with some sharks detected for longer than 600
days. The mean percentage of time C. amboinensis and C. sorrah spent inside
MPAs was 22% and 32%, respectively. MPA use varied seasonally, with C.
amboinensis spending a higher percentage of time inside MPAs in summer (mean =
28%) and C. sorrah spending a higher percentage of time inside MPAs in winter
(mean = 40%). Although sharks used large areas inside MPAs, most tended to use
only half of the available protected space. In addition, all sharks made
excursions from MPAs, but both species exited and re-entered at consistent
locations along the MPA boundaries. This research shows that MPAs have
potential conservation benefits for shark populations by providing protection
across different species and life stages, and demonstrates how tracking studies
can be used to help tailor MPA design to maximize their effectiveness.
McFarlane, Gordon A. (Fisheries and Oceans Canada);
Cisneros, Andres (UBC, Canada); King, Jacquelynne (Fisheries and Oceans Canada,
Canada); Sumaila, Rashid (UBC, Canada)
Economic Impacts of Shark Conservation in
British Columbia
Although data-deficiency often hinders formal assessments,
it is widely recognized that shark species around the world have historically
been overfished. In British Columbia, three shark species have been listed
under the Species at Risk Act (SARA) as Endangered or Special Concern.
Currently these listings have not required bycatch mitigation in fisheries
which encounter these shark species. It is recognized that conservation
measures in the form of fishery restrictions will have economic costs from the
adaptation of an industry to new restrictions. In the case of fisheries these
costs follow from limitations on catch (targeted or incidental) leading to
reductions in fishing effort, which can result in lowered catch and profits. We
examine the potential economic costs of mandated bycatch reduction, with a
conceptual case study. We chose two model species: bluntnose sixgill shark
(Hexanchus griseus) which is the most common SARA-listed bycatch species in the
British Columbia groundfish fishery; and Pacific halibut (Hippoglossus
stenolepis) which is the most economically important groundfish fishery in
British Columbia. We ask the overarching question: Under current fishing
conditions, what effect might sixgill shark bycatch limitations have on the BC
halibut fishery?
Wimmer, Tonya (WWF-Canada); Corke, Jarrett (WWF-Canada, Halifax,
NS, Canada); Cooper, Ernie (WWF-Canada / TRAFFIC, Vancouver, BC, Canada);
McFarlane, Gordon A. (Fisheries and Oceans Canada, Nanaimo, BC, Canada)
Developing priorities for the conservation and
management of sharks in Canada
Globally, over the last two decades, shark conservation
and management has emerged as a major priority for marine conservation. In 1999
the Food and Agriculture Organization (FAO) developed an international
framework for shark conservation. This framework recommends that all States
with fisheries impacting shark species should participate in their management
and develop National Plans of Action (NPOA) to identify information gaps, issues
and priorities for their conservation and management within their jurisdiction.
Despite international commitments, there has been little action undertaken to
better understand, manage and protect elasmobranch species in Canadian waters.
The only exceptions to this are species for which there is commercial interest
(e.g. Pacific spiny dogfish and porbeagle) or species which interact with
commercial fisheries (e.g. shortfin mako, tope and sixgill). Canada has
developed an NPOA which has some useful information on commercial shark stocks.
However, it does not specify actions, priorities or timelines to assess or
mitigate threats to non-commercial species, nor does it adequately address
issues throughout Canada. Furthermore, Canadas NPOA was developed with no stakeholder input, which is a critical step to developing
comprehensive and meaningful plans as identified by the FAO. To address this,
WWF-Canada hosted regional forums on the Atlantic and Pacific coasts that
brought together experts from government, industry, conservation, tourism and
academia to discuss the conservation of sharks. In total, 42 people
participated in the Atlantic Shark Forum and 37 in the Pacific Shark Workshop
(including several international experts). The goal of each forum was to discuss
the most pressing issues for sharks in regards to science, on-the-water
practice and policy & management and to determine the top priorities which
would significantly advance the conservation and management of shark species in
Canadian waters. Despite regionally specific differences, the top priorities
for both regions fell into three broad categories: 1) more and better
information on stock status and catch data for all species; 2) increased
education, training and information sharing about sharks, conservation issues
and initiatives; and 3) advance understanding and research on mitigation
measures and handling practices to minimize mortality of sharks. This
information and the collaborations that have resulted will be essential to the
development of national and regional action plans to address threats to these
species.
Davidson, Lindsay (Simon Fraser University); Dulvy,
Nicholas (Simon Fraser University, Canada); Fordham, Sonja (Shark Advocates
International)
How much of the world's shark fishing is
sustainable?
Unregulated catches of sharks and rays (hereafter sharks) for their fins and meat are
driving population declines and elevating extinction
risk. Demand for shark products has increased sharply since the 1980s and
remains strong, not only for shark fin, but also meat from previously
undesirable species such as blue shark. Implementation of management measures
to control this rapidly rising mortality have been sluggish and existing restrictions lack consistency across species
ranges. Here we ask what proportion of the worlds chondrichthyan catch is
likely to be sustainable. We make the pragmatic and to-be-tested assumption
that countries with adequate shark plans are fishing sustainably. In order to
identify hotspots of conservation action and requirement, we describe the
nation-by-nation spatial distribution of chondrichthyan biodiversity patterns,
catch levels, shark fin exports, and strength of shark plan. We found that less
than half of the top 20 sharks fishing nations with the greatest reported catch
have yet to implement a shark plan, and a quarter have yet to implement some
form of shark finning ban. Moreover, hotspots of shark biodiversity occur in
national waters with high fishing mortality of sharks and low levels of shark
fisheries management.
Henning 201, Friday 14:00; Chair Chris Lowe; AES Gruber
Award 2.
Dell'Apa, Andrea (East Carolina University);
Cudney-Burch, Jennifer; Rulifson, Roger (East Carolina University, Greenville,
NC, United States)
Male:Female Ratio Changes In Spiny Dogfish
(Squalus acanthias) Fishery-Dependent Surveys In Cape Cod, MA: Fishery
Management Aspects
The
international exploitation of the sexually dimorphic spiny dogfish (Squalus
acanthias) is driven by the European market, which demands for large females.
This sex-selective fishery led to over-exploitation of the US Atlantic stock,
forcing the adoption of a Fishery Management Plan (FMP) to rebuild it. The
species biological characteristics (long gestation period, slow growth rate),
and the targeting of adult females, raise concern on the conservation status of
dogfish worldwide, leading to the discussion for inserting the species in the
CITESs list for regulating the trade. In case of listing, a fishery must
provide for its sustainability in order for the stock to be commercialized. The
sustainability of the US Atlantic dogfish stock is measured based on the
biomass of adult females. Given the decrease in adult females reported for this
stock over the last decade, alternative management strategies to enhance the
fishery sustainability are needed. One possibility currently unexplored would
be the development of a male-only directed fishery. The aim of this research is
to test for significance in the male:female ratio changes in commercial surveys
conducted in the Cape Cod, MA area, where local fishers observe higher
abundance of males early in the day and higher presence of females as the day
progresses. Results suggest the possibility for a male-only directed longline
fishery within 10 miles off the coast of the Cape Cod Peninsula, where higher
presence of schools of males occur in shallower water early in the day and at
different fishing seasons. These results also support the employment of
standardized research effort in the study area to monitor fine-scale behavior
patterns of males through day and season in order to characterize male dogfish
movements and to assess whether a male-only directed fishery in the area is
viable.
Kroetz, Andrea (University of South Alabama, Dauphin Island Sea
Lab); Drymon, J. Marcus (Center for Ecosystem Based Fishery Management, Dauphin
Island Sea Lab); Powers, Sean P. (University of South Alabama, Dauphin Island
Sea Lab)
Did the Closure of Katrina Cut Impact the
Movements of a Coastal Shark?
Bonnetheads (Sphyrna tiburo) are highly mobile fish that
occupy dynamic coastal environments. Identifying the factors influencing the
distribution of these fish is essential for understanding potential impacts
induced from anthropogenic alterations to coastal ecosystems. Dauphin Island is
a barrier island that was split into two halves in 2005 by Hurricane Katrina.
This opening, known as Katrina Cut, allowed for water flow between the Gulf of
Mexico and Mississippi Sound and also served as a potential passageway for
mobile consumers to move freely between the two water bodies. Following the
Deepwater Horizon oil spill in 2010, Katrina Cut was closed off by a solid rock
wall in an attempt to prevent oil from reaching the shoreline. Acoustic
telemetry was used to assess if altering Dauphin Islands natural coastline
hindered ingress/egress of bonnetheads into Mississippi Sound. There were
changes in bonnethead movement from 2010-2011. Prior to the closure of Katrina
Cut, bonnethead detections were concentrated in a small area proximal to the
cut during spring and summer of 2010. Following the closure of Katrina Cut,
telemetered sharks relocated to the west tip of Dauphin Island and Petit Bois
Island, MS during spring and summer 2011. A shift in preferred prey, habitat or
abiotic parameters all present possible explanations for the shift in
distribution of this coastal shark. Regardless of the mechanism, acoustic
telemetry presents a means by which to identify a rapid shift in habitat use by
a mobile consumer in response to an anthropogenic alteration.
Stump, Kristine (University of Miami - RSMAS);
Crooks, Christopher (University of Manchester, Manchester, United Kingdom);
Gruber, Samuel (Bimini Biological Field Station, Miami, FL, United States)
Hunted hunters: an experimental test of the
effects of predation risk on juvenile shark habitat use
The
effects of predation on a species occur either directly, through consumption,
or indirectly as risk effects. Risk effects arise when prey alter their
behavior in an attempt to decrease encounters, detection and/or capture. Often,
a perceived predation threat leads to risk effects which manifest as changes in
habitat use by the prey species, and these effects can be significant and even
greater in consequence than direct effects. In Bimini, Bahamas, neonate and
juvenile lemon sharks (Negaprion brevirostris) use mangrove-fringed shorelines
as nursery areas in part due to the protection afforded from predators, namely
larger conspecifics. We investigated the small-scale use of mangrove structure
by neonate and juvenile lemon sharks as an anti-predatory response to predation
risks. Controlled experimental trials were conducted on captive sharks to
assess the degree of the sharks use of artificial mangroves when solitary,
with a size-matched conspecific and with a potential predator (subadult
conspecific). Results showed a significant increase in use of artificial
mangroves when in the presence of a potential predator as compared to when with
a size-matched conspecific. In addition, a significant negative correlation was
found between body size and the use of artificial mangrove structure when in
the presence of a potential predator, indicating that size is an important
factor in anti-predatory behavior.
Kolmann, Matthew (Florida State University); Huber,
Daniel (University of Tampa); Dean, Mason (Max Planck Institute); Grubbs, Dean
(Florida State University Coastal & Marine
Laboratory)
Feeding performance in a durophagous stingray
Durophagy is a feeding strategy which is
typified by the majority of an organisms diet being comprised of hard-shelled invertebrates. Implicit in this definition is not
only the ingestion of hard-shelled prey but also the mechanical dismantling of the prey
carapace. The cownose ray, Rhinoptera bonasus, is a large coastal pelagic
stingray thought to
specialize on
bivalve prey. Investigation of
feeding performance in such an animal is particularly interesting in such that the rays skeletal structure
is oftentimes much more compliant than the skeleton of its prey. Using traditional morphometric analysis of jaw
adductor muscle architecture coupled with physiological estimations of muscle forces we use a
three-dimensional static
equilibrium model
which calculates bite forces in cownose rays over their ontogeny. Additional
considerations of our model include
the notion of asymmetrical biting and a jaw lever system shift which maximizes mechanical advantage.
Here we present the first biomechanical
model for a myliobatiform stingray using bite force as a performance metric. Preliminary data regarding bite force
production in Rhinoptera over their ontogeny show force production spanning
from 17 N in neonate animals to
over 200 N in mature adults. Concern regarding the effect of cownose ray predation on
commercial bivalve species is addressed
with consideration to ecomorphology, specifically how high bite forces in Rhinoptera translate to feeding success on commercial
shellfish.
Matich, Philip (Florida International University); Heithaus,
Michael (Florida International University, North Miami, FL, United States)
Resource pulses drive seasonal variability in
bull shark trophic ecology
Estuaries are characterized by considerable variation in
both abiotic and biotic conditions across multiple spatial and temporal scales.
This variation can lead to spatial and termporal variation in food web
dynamics. Within the Florida Coastal Everglades, much of the estuarine habitat
is oligotrophic, and prey resources for upper trophic level predators are
generally scarce. Thus, resource pulses that enter the ecotone region of the
estuary during the dry season when marsh species migrate to channels, could be
important in the diets of estuarine predators. We used stable isotope analysis
of an estuarine top predator, juvenile bull sharks, to elucidate variation in
trophic interactions in space and time and with changes in shark size. Carbon
isotopic values of bull sharks in the Shark River Estuary suggest that they
take advantage of the freshwater resource pulse during the dry season. However, data suggest that all sharks
do not rely on this pulse of food, which may be attributed to physical
tolerances, trade-offs, prey preference, foraging experience, and/or individual
specialization. Our study shows the potential importance of large, highly
mobile predators, like bull sharks, in linking freshwater and estuarine food
webs, and the complexity of Everglades trophic dynamics. Further research
investigating the timing of these resource pulses and quantifying the biomass
that enters channels during the dry season may provide insight into how the
physical changes caused by proposed restoration efforts may lead to important
biological changes.
McCallister, Michael (University of North Florida);
DiGirolamo, Tony (Florida Fish and Wildlife Commission); Gelsleichter, Jim
(University of North Florida)
Understanding the effect of prey abundance on
habitat selection for the Atlantic sharpnose shark (Rhizoprionodon terraenovae)
in a northeast Florida estuary
Sharks are considered top predators in many marine
ecosystems, and can play an important role in structuring those communities. As
a result, it is important to understand the factors that influence the
abundance and distribution of sharks.
One hypothesis is that the abundance and distribution of predators is
driven by the abundance of potential prey resources. The goal of this study was
to examine the influence of prey abundance on habitat selection for Atlantic
sharpnose sharks in a northeast Florida estuary. Atlantic sharpnose sharks were
caught in Cumberland Sound from 2009 – 2011 and catch rates were compared
between open sound habitat and protected creek habitat. Stomach contents of
sharks caught in 2010 –2011 were analyzed to determine the preferred prey
items of Atlantic sharpnose sharks. The abundance of potential prey items in
sound and creek habitats was determined from finfish abundance data obtained
from the Florida Fish and Wildlife Conservsation Commission. Catch rates of
Atlantic sharpnose sharks in open sound and creek habitat were compared with
the abundances of their preferred prey items found in those habitats.
Understanding patterns of habitat use and foraging behavior can provide insight
on how predators select habitat, and the importance of those habitats. This is
particularly important as management efforts continue to focus on identifying
essential fish habitats.
Fernandez de Carvalho, Joana (Center of Marine Sciences
(CCMAR)); Coelho, Rui (CCMAR, Faro, Portugal); Neves dos Santos, Miguel
(IPIMAR, Olho, Portugal); Erzini, Karim (CCMAR, Faro, Portugal)
Life history of the bigeye thresher shark,
Alopias superciliosus, in the Tropical Eastern Atlantic Ocean
The
bigeye thresher, Alopias supercilious, is commonly by-catch in pelagic longline
fisheries targeting tunas and swordfish. Still, very little information is
available for this species life history in the Atlantic Ocean. As part of the
EU Data Collection Regulation framework, Portuguese fishery observers have been
placed aboard fishing vessels collecting information on captures, size, sex, maturity
stage, and biological samples such as vertebrae. A total of 760 bigeye
threshers were recorded between 2008 and February 2011, throughout the
Atlantic. In the NE Atlantic, almost all size classes were observed and there
was a higher proportion of females (65.08%). In the SE Atlantic, larger
specimens were found and the presence of males (56.12%) was higher than
females. Vertebrae of 356 bigeye threshers were collected and analysed so far.
These were collected along a wide geographical range (between 18oN and 28oS),
mostly along the East Atlantic, with size of specimens ranging from 101 to 265
cm fork length (FL). Preliminary trials were carried out to determine the most
efficient band enhancement technique for this species, in which crystal violet section
staining was found to be the best methodology. A linear relationship between
specimen size and vertebrae diameter was found and observed vertebrae showed 1
to 22 pairs of opaque and hyaline bands. Preliminary growth models based on the
Von Bertalanffy growth function (VBGF) and the VBGF with fixed size at birth
were calculated and the parameters are presented and discussed. Maturity ogives
were fitted for 402 specimens that had maturity data available, and size at
first maturity was estimated at 206.1 cm FL for females and 159.7 cm FL for
males. The results presented in this paper can be used and integrated in future
ecological risk analysis and stock assessment models for this species in the
Atlantic Ocean.
White, Easton (Arizona State University); Nagy, John (Scottsdale
Community College, Arizona State University); Gruber, Samuel (Bimini Biological
Field Station,)
A stage-structured stochastic model of lemon
shark population dynamics
While some general mathematical models of shark population
dynamics have been important in fisheries management, there is a need for more
detailed treatments to assess causes of population fluctuations. For example,
nursery sites are an important habitat element for juvenile lemon sharks (
Negaprion brevirostris ), exposing this species to potential anthropogenic
impacts not faced by pelagic species. However, nursery site use has been
largely overlooked in mathematical population models. Here we define a novel
stage-structured, Markov chain stochastic model to study how this life history
characteristic interacts with demographic stochasticity to generate
fluctuations in lemon shark populations. We show that demographic stochasticity
accounts for 27 to 40% of the variance observed in a 17-year, longitudinally
studied population of lemon sharks. We therefore, conclude that unmodeled
environmental factors can be important drivers of interannual population
fluctuations. These factors may include habitat loss, weather patterns, global
climate change, and random catastrophic events. Our model is easily applicable
to many large vertebrate predators in which age structure and demographic
stochasticity are important considerations. It may also be used to estimate
demographic parameters that cannot be feasibly estimated in the field
Henning 202, Friday 14:00; Chair Lucy Harrison;
Elasmobranch Conservation 2.
Lana, Fernanda (Federal Rural University of Pernambuco); Hazin,
Fbio; Oliveira, Paulo; Rego, Mariana; Roque, Pollyana (Federal Rural
University of Pernambuco, Canada)
Reproductive Biology, Relative Abundance and
Distribution of Silky Shark, Carcharhinus falciformis (Muller & Henle,
1939), in the Southwestern and Equatorial Atlantic Ocean
The present work aimed at studying the ecology of the
silky shark, Carcharhinus falciformis , including aspects of its reproduction,
relative abundance, distribution, habitat use and migration in the Equatorial
Atlantic Ocean. From November 1992 to December 2011, 153 specimens were
examined, 72 males and 81 females, resulting in a sex ratio close to 1:1
(0.89:1.00). All specimens were caught by commercial tuna longline boats, in
the area located between the latitudes of the 008N to 053S and longitudes
008E to 048W. The results suggest a size at first maturity for females around
205- 210 cm and for males between 180- 205 cm TL. Females were found in 5
maturational stages: juvenile (n = 29/ 35.8% from 74 - 204 cm, TL), maturing (n
= 10 / 12.3%, from 215 - 295 cm TL), pre- ovulatory (n = 14 / 17.3%, 177 - 280
cm TL), pregnant (n = 24 / 29.6%, 203 - 270 cm TL) and resting (n = 4 / 4.9%,
from 223 - 285 cm TL). Males were classified into 4 stages: juvenile (n = 38/
52.8% from 81 - 220 cm TL and clasper length - CL <12 cm), maturing (n =
16/ 22.2%, from 166 - 208 TL cm, 9.5 - 24.5 cm CL;), adult (n = 17/ 23.6%, from
141 - 272 cm TL, CL> 24.5 cm) and neonate (n = 1/ 1.4%, 82 cm TL, CL 4
cm). The ovarian fecundity ranged from 2 to 60 follicles and uterine fecundity
from 7 to 25 embryos. The distribution and relative abundance were analyzed
based on catch and effort data from 16.016 sets made by Brazilian tuna
longliners, from 2004 to 2011. The area with the highest concentration was
located between latitudes 005oN and 020oS and between longitudes 020oE and
040oW. The proportion of silky sharks in relation to the total catch in numbers
and catches of sharks in general, equal to 0.2% and 6.4%, respectively, were
very low, showing the character of their incidental catches. The habitat
preferences and their distribution in depth, temperature ranges and vertical
movement, were analyzed using PSAT tags (Pop-up Satellite Archival Tag) in the
vicinity of Archipelago of Saint Peter and Saint Paul – ASPSP. Two males
of silky sharks of 130 cm and 100 cm TL each were tagged with PSAT programmed
to remain in the animal for 73 days collecting data. The preferred temperature
range displayed by the species was between 27 - 28 C with a preferred depth
between 1 - 10m, showing a markedly shallow distribution for the species. The
animals also exhibited a marked superficial behavior during the day and a
little deeper at night.
Clarke, Tayler (University of Costa Rica); Espinoza Mendiola,
Mario (James Cook University); Villalobos, Fresia; Wehrtmann, Ingo (Unidad de
Investigacin Pesquera y Acuicultura, Universidad de Costa Rica)
Reproductive ecology of four elasmobranch
species in the Pacific coast of Costa Rica, Central America
Sharks and rays are a common component of the bycatch in
many tropical demersal trawling fisheries. The elasmobranch bycatch of the
commercial shrimp trawling fishery operating along the Pacific coast of Costa
Rica is comprised by a total of 24 species. In data deficient fisheries such as
this one, life history may be used as a valuable tool to identify vulnerable
species and apply precautionary measures that could ensure their long-term
conservation. Therefore, we studied the reproductive ecology of Raja velezi,
Mustelus henlei, Zapteryx xyster and Torpedo peruana associated to the
commercial deepwater shrimp fishery along the Pacific coast of Costa Rica. This
information was used to identify essential habitats and recommend management
measures for elasmobranchs in Costa Rica. A total of 217 tows were carried out
at 25-350 m from March 2010 to September 2011. During this period, a total of
751 individuals of R. velezi , 569 M. henlei , 394 Z. xyster and 157 T. peruana
were obtained. The size at sexual maturity was estimated as: 52-56 cm TL for R.
velezi, 39-43 cm TL for M. henlei , 45-47 cm LT for Z. xyster and 54-65 cm LT
for T. peruana . Fecundity increased with female length. M. henlei presented
between 1 and 12 embryos, and Z. xyster carried between 1 and 9 embryos.
Segregation by size and sex was detected in all species, mainly related to
depth. Most gravid females were found at depths >50 m along the Pacific
coast. However, some areas such as the Golfo de Nicoya, the Quepos-Manuel
Antonio wetlands and the Humedal Nacional Trraba-Sierpe (HNTS) presented large
aggregations of gravid females and immature individuals. We recommend the
protection of these critical habitats and the creation of discrete fishing
closures at depths 50 m along the Pacific coast of Costa Rica.
Jaez, Julieta (Fundacion Temaiken); Zalazar, Raul; Falzone,
Martin; Abraham, Carolina (Fundacion Temaiken)
Preliminary observations on the reproductive
cycle of Myliobatis goodei in captivity
Elasmobranchs can be grouped in three types of
reproductive cycles. Continuous breeders are reproductively active throughout
the year, seasonal breeders are reproductively active for only a portion of the
annual cycle, and species that undergo punctuated cycles are pregnant for
approximately a full year, but an intervening year or two is spent
non-pregnant. The Southern eagle ray (Myliobatis goodei) is widely distributed
along the Atlantic east coast, from USA (36 N, South Carolina) to Argentina
(36 S, Patagonia). The mode of reproduction is aplacental viviparity
(Matrotrophic-histotrophe). However, the basic reproductive parameters are yet
unknown. Preliminary data of the reproductive cycle obtained from adult females
in captivity are presented. Observations in five females of M.goodei,
maintained under controlled conditions during the period 2003-2011, allowed us
to determine that the elapsed time between births is about one year. These occur
in late spring-summer and copulation occurs immediately after parturition. A
minimum of 4 months gestation was estimated by ultrasound. Parturitions in
consecutive years were recorded for two reproductive females. From the
ultrasound monitoring of two females that were isolated from the rest of the
specimens for one year, follicular development was observed, with a peak in the
diameter reached in May-June (winter). Estrogen levels in blood showed a peak
in early summer and another in late spring. During the rest of the year
(autumn-winter) estrogen concentration was maintained at low levels.
Testosterone showed several oscillations during the year with a marked decrease
in late summer and two peaks between late winter and spring. As for the
progesterone, values were below the detection limit of the measuring equipment
(<0.1 ng/ml). Observations to date allow us to affirm that M. goodei
presents an annual reproductive cycle, and to discard the punctuated cycle as
its reproductive strategy. However, further studies are needed to determine
whether the reproductive cycle of the species is seasonal or continuous.
Passerotti, Michelle (NOAA/NMFS); Andrews, Allen
(NOAA/NMFS, Aiea, HI, United States); Carlson, John (NOAA/NMFS, Panama City,
FL, United States); Wintner, Sabine (KwaZulu-Natal Sharks Board, Umhlanga
Rocks, South Africa); Natanson, Lisa (NOAA/NMFS, Narragansett, RI, United
States)
Age validation in sand tiger shark, Carcharias
taurus, using bomb radiocarbon analysis
There is a great deal of ambiguity in the age and growth
data of sand tiger shark (Carcharias taurus). Of particular concern is the
observed maximum age based on vertebral band counts. To address this
uncertainty, archival vertebrae of sand tiger sharks from both the north
Atlantic and south Indian Oceans were processed for bomb radiocarbon analysis
in an effort to validate growth band periodicity and longevity in the species.
Vertebral centra from 10 individuals were chosen for analysis based on capture
date and size at capture, and sectioned to a thickness of 2mm using an Isomet
low speed saw. One half of the section was left at this thickness and mounted
for micromilling, while the other half was sanded to a thickness of 0.5mm and
mounted for ageing. Age estimates for each shark were obtained by counting
growth band-pairs assuming annual band-pair deposition, and were used in
conjunction with date of capture to assign a year of formation for each
band-pair. Thin sections were used to guide marking of band-pairs on thick
sections. A total of 36 growth band-pairs were milled from thick sections (n= 2
to 6 per vertebrae) for Δ14C/δ13C analysis. The measured Δ14C
values for band-pairs/formation years will be compared with regional Δ14C
reference chronologies including known-age porbeagle shark (Lamna nasus) and
hermatypic corals. This comparison will either validate age estimates or will
provide evidence for discrepancies in age from growth band counting. New
estimates of age at maturity and longevity will be used to update the
productivity for this species, which current data estimates to be strikingly
low (i.e. population growth rates are negative) even in the absence of fishing
pressure.
Semba, Yasuko (National Research Institute of Far Seas
Fisheries); Shono, Hiroshi (Kagoshima University, Kagoshima); Yokawa, Kotaro
(National Research Institute of Far Seas Fisheries, Shizuoka, Japan)
Distributional pattern of shortfin mako, Isurus
oxyrinchus, by ontogenetic stage and sex in the western and central North
Pacific
Shortfin mako, Isurus oxyrinchus, is a large pelagic shark
with wide distribution from the tropical to temperate oceans. This species are
suggested to have long life span and be sexually dimorphic in various aspects
such as maximum size and life history traits. Recent studies on life history
traits suggest that females grow larger and live longer than males with much
longer time to attain sexual maturity. These aspects are suggested to be
closely linked to their behavioural aspects, which was supported by the report
on the sexual segregation of this species. Considering the long life span and
difference of life history schedule between the sexes, ontogenetic stage is
also important factor to affect the distributional pattern of this species.
This study focused on the ontogenetic aspects of the distributional pattern of
this species and described the temporal and spatial pattern by ontogenetic
stage (i.e. juveniles and adults) and also by sex, based on the fishery and
research data in the western and central North Pacific Ocean. In the juvenile
stage, both males and females frequently occurred in the northwestern part
(higher than 30N and west of the dateline), while the distribution of females
in the subadult stage tended to shift to the south and the east. In adult
stage, males exclusively occurred in the southeastern part (lower than 30N and
east of the dateline) with some seasonal fluctuation, while females, both
pregnant and non-pregnant, were caught widely across the North Pacific from
subtropical and temperate areas. The results in this study suggest the clear
ontogenetic difference in the distributional pattern and possible sexual
difference in each ontogenetic stage. Further research and effort to collect
the size data by sex are necessary to understand the complex distributional
pattern of I. oxyrinchus by sex and ontogenetic stage. Combination of fishery
and research data would provide important information on the ecology of sharks,
especially for species with wide distribution in the pelagic ocean.
Marquez-Farias, J Fernando (Facultad de Ciencias del Mar.
Universidad Autonoma de Sinaloa. Mexico); Smith, Wade (Oregon State University,
Corvallis, OR, USA.); Rodrguez Lpez, Jorge E; Lara-Mendoza, Raul E. (Facultad
de Ciencias del Mar. Universidad Autnoma de Sinaloa. Mexico)
Growth and migration of Scalloped Hammerhead
Shark Sphyrna lewini from the Nursery in the Southern Gulf of California,
Mxico
In the absence of parental care, some species shark used
shallow areas for the birth of their offspring. In these areas, the newborn
will find food and protection against predation. The cohort of sharks that born
in a given season does not migrate from the breeding area until they achieve a
certain size. However, prior to migration, the cohort of newborns must survive
to birth and stay alive in the nursery area. We investigated the hammerhead
sharks in the coastal zone of southern Sinaloa monitoring the artisanal shark
fishery. Based on observations of the umbilical wound condition was possible to
determine the state of development which was encoded in open (0= neonate) and
closed (1= juvenile). Using a binary logistic regression, we determined the
proportion of neonates (y) that survive to birth as function of length (x). The
value of L50% of the logistic function represents when half the cohort survived
the birth event given the healed wounds. We note that sharks are born around 43
cm TL in late May and reach L50% = 53 cm TL in few weeks. The growth of
juveniles continues until February of the following year. At 83 cm TL, half the
cohort born in the season has migrated from the nursery area. We discuss the
sources of natural mortality for age-0 and the implications of directed fishing
in nursery grounds.
Sulikowski, James (University of New England);
Carlson, Amy; Knotek, Ryan; Peterson, Cassidy (University of New England);
Bubley, Walter (Texas Parks and Wildlife Division);
Driggers, William; Hoffmayer, Eric (National Marine
Fisheries Service, Canada); Tsang, Paul (University of New Hampshire)
Spiny Dogfish: How new hypotheses', new data,
and a little luck, may lead to a better understanding of this species in the
U.S. western north Atlantic Ocean
The spiny dogfish, Squalus acanthias , was once considered
to be the most abundant shark off the east coast of the United States. As a result
of reported declines in abundance, a management plan was implemented in 2000
which imposed annual quotas and possession limits in both federal and state
waters. Due to characteristics such as slow growth, long gestation, small brood
size, and an estimated spawning stock biomass (SSB) below threshold levels, the
spiny dogfish population was not anticipated to rebound until 2020. However,
increases in the SSB have recently occurred that cannot be explained when
considering what is known about the biology of this species. Based on the
previously reported population decline and the life history characteristics of
this shark, conservation groups are suggesting the species should be protected.
In contrast, the commercial fishing industry believes spiny dogfish are
actually abundant and are adversely
impacting commercially important groundfish stocks. Thus, state and
federal agencies charged with managing this species are in the middle of a
volatile issue. We present data to support hypotheses that are divergent to
common paradigms: 1) this shark has a more active vertical movement pattern
that prevents representative sampling during trawl surveys used for stock
assessment purposes; 2) this species horizontal movement patterns are more
regional than previously thought; 3) this shark reaches sexual maturity faster
and has a shorter gestation period than the literature suggests (resulting in
an increased reproductive output); and 4) that a larger dogfish population will
impact the ecosystem.
Jirik, Katherine (Birch Aquarium at Scripps
Institution of Oceanography);
Reconciling professional values: a foundation to
improve collaboration and communication in elasmobranch scholarship
Elasmobranch researchers participate in numerous roles
within scientific and public spheres. Researchers commonly give public
lectures, serve as technical consultants, confer with managers, and encourage
community projects in addition to their scientific and institutional
responsibilities. Despite advances in technology and communication, much
responsibility falls on individual researchers to disseminate their findings
and sustain a public presence. This often requires not only explaining
research, but interpreting research – a practice influenced by the values
of science and society. To what extent do elasmobranch researchers feel
comfortable doing this? What types of engagement are appropriate for the objective scientist? As elasmobranch
scholarship continues to diversify, how can the limitations of disciplinary
values be recognized, and yet, be used to complement one another in order to
solve problems? This paper revisits the object-subject debate and aims to help
elasmobranch scholars reflect on whether different professional values are
needed in their scientific and public roles, and how values may affect
cross-disciplinary scholarship and collaboration. Survey results of scientists
attitudes towards engagement in the public sphere will be presented.
Friday Poster 1 Session:
Elasmobranch Behaviour & Ecology. Starting a 5:00 PM
Anderson, James (University of Hawaii Institute
of Marine Biology); Johnson, Ryan (Oceans Research); Bester, Martin (University
of Pretoria); Swanson, Stephan (Oceans Research); Gennari, Enrico (Rhodes
University)
Impact of small scale chumming activities on the
movement patterns of white sharks
(Carcharodon carcharias) in Mossel Bay, South
Africa
Shark cage diving has become both a popular and
controversial activity at numerous locations around the world. Such activities
are widely argued to have economic and educational values with minimal impacts
upon a natural resource. Critics of the cage diving industry claim increased
risks for public safety, as well as environmental and ecological impacts. In
South Africa, the cage diving industry is largely focused on the white shark
(Carcharadon carcharias) at three main centers; Mossel Bay, Gansbaai and False
Bay. It is documented that at least 15% of the white shark population in these
areas move between these sites, whilst Mossel Bay supports a semi-resident population
of female white sharks that may stay in the area for upwards of six months.
Movements of white sharks (n=15) in Mossel Bay were analyzed in relation to the
activity of the sole cage diving operator between 2005 & 2009. Sharks were
tracked over several days both with and without concurrent cage boat activity.
Putative behavioral change was observed in individual sharks both in relation
to the activity of the cage boat and as a function of experience. The study
demonstrates natural behavioral patterns of sharks may be altered by methods
employed by cage dive vessels (chumming), but such behavioral changes may be
short term and reversible. No reliable evidence was gained to either support or
refute that such behavioral change conveys increased risks for public safety,
or may have long term ecological impacts.
Araujo, Maria Lucia (FAPESE/UFS); Melo, S.M.V.
(Secretaria do Meio Ambiente)
Impact of ornamental fishery on reproduction of
Potamotrygon sp C (CHONDRYCHTIES POTAMOTRYGONIDAE)
The species Potamotrygon sp C, is a small freshwater
stingray that it exhibits as reproductive mode matrotrophic viviparity, with
the reproductive potential of the species directly proportional of female size.
Recent speculations on reduction of its population by ornamental fishing have
been pointed out without any data on population abundance. The purpose of this
study is to measure the impact of ornamental fishing on wild stocks of Potamotrygon spC. To assess fishing impact we
considered the minimum size of reproduction (DW50 and DW95) with 95% CI and
reproductive potential of the species in areas with different levels of fishing
effort. DW50 andDW95 of the area with higher fishing impact (area 1) were 17.30
cm (17.08- 17.52) and 19.09 cm (18.53-19:66), respectively. The average of
uterine fecundity was 2.08 ( 1.35). DW50 andDW95 of the areas with lower
fishing impact (area 2) were 16.71 cm (15.91-17:43) and 21.31cm (18.57-24.04),
respectively. The average of uterine fecundity was 2.28 ( 1.07). Cerrato test
showed no significant differences on DW50 andDW95 between the two areas.
(χ20.05=78.15; Likelihood ratio = -53. 96). The t test showed no significant differences
between average of uterine fecundity (p = 0.33). These results indicate that,
although theDW95 of the area 1 is lower than area 2, the reproductive potential
of the species has not been compromised, and therefore ornamental fishing did
not cause significant impacts on wild populations.
Bigman, Jennifer (Moss Landing Marine
Laboratories); Bizzarro, Joseph (Friday Harbor Laboratories, Friday Harbor,
United States); Ebert, David (Moss Landing Marine Labs, Moss Landing, United
States)
North Pacific spiny dogfish (Squalus suckleyi)
trophic ecology: using integrated gut content and stable isotope analysis to
infer short and long term feeding trends
North Pacific spiny dogfish (Squalus suckleyi) are
commercially and ecologically important predators that are abundantly
distributed in North Pacific waters, and therefore may play an important role
in regional marine ecosystems. Most historic research on this species has been
focused on dogfish collected within the inland waters of Washington and British
Columbia, but little is known about offshore populations. We used traditional
gut content analysis (GCA) and stable isotope analysis (SIA) to elucidate the
trophic ecology of dogfish from central California, U.S.A. GCA allows for
quantification of prey items contained within the stomach of a single
individual and reveals what actual species are consumed on a short-term basis.
SIA uses elements as tracers (specifically carbon and nitrogen) to identify
predator-prey relationships as well as trophic position, allowing for long-term
diet information. SIA analysis can be used to complement gut content data via
integrating both short and long term food habits, enhancing information known
about the trophic role of a given species. Based on GCA, the most abundant and
important prey taxa by number, weight, and the prey-specific index of relative
importance wer euphausiids, fishes, and cephalopods. Similarly, the most
frequently occurring prey taxa were fishes, euphausiids, and cephalopods. In
addition to diet composition, sources of dietary variability with respect to
size, sex, depth, location, season, and year are being investigated for GCA and
SIA and will be presented.
Churchill, Diana (Florida International
University); Heithaus, Michael R. (Florida International University, North
Miami, FL, United States); Grubbs, Dean (Florida State University, St. Teresa,
FL, United States); Vaudo, Jeremy (Florida International University, North
Miami, FL, United States)
Effects of the Deepwater Horizon Spill on the
trophic interactions of deep-sea sharks and associated species of the Gulf of
Mexico.
The Deepwater Horizon oil spill (DwH) was significant not
only in the amount of oil, but also the depth of the release and the
unprecedented subsurface use of dispersants. Therefore, the benthic
contaminants from the spill may have had significant impacts on the poorly
characterized deep-sea communities of the northern slope of the Gulf of Mexico
(NGS). We explored the potential impacts of the DwH on deep sea food webs by
comparing trophic interactions of upper level predators (sharks, teleosts) and
benthic scavengers (crabs, giant isopods, hagfish) from sites located in close
proximity to the spill site (NGS) and sites at similar depths located 400 km
from the spill along the west Florida slope (WFS). We also took advantage of
samples from the WFS sites collected prior to the spill to investigate temporal
variation in trophic interactions of representative species. We assessed
trophic interactions using a combination of stomach contents and stable isotope
(δ13C and δ15N) analysis. Stomach contents analysis revealed the diet of Cuban dogfish (Squalus cubensis), the numerically dominant
elasmobranch, to be composed of shrimp, cephalopods and mesopelagic fishes,
with slight variation in their relative contributions to diets in the NGS and
WFS sites. Cuban dogfish δ13C isotope values varied slightly between the
NGS and WFS sites. In general across all
species, there was little interspecific variation in isotopic values within and
between sites. These results, however, are based on the first of a series of
sampling events after DwH and because of likely slow isotopic turnover rates in
deep-sea organisms may not yet reflect potential changes in trophic structure
after the spill.
Coelho, Rui (Centre of Marine Sciences (CCMAR)); Erzini, Karim
(Centro de Cincias do Mar (CCMAR), Faro, Portugal)
Demographic analysis of the velvet belly lantern
shark, Etmopterus spinax, caught and discarded by trawl fisheries in southern
Portugal (NE Atlantic)
The velvet belly lantern shark, Etmopterus spinax, is a
deep-sea shark usually caught as by-catch and discarded in deep water
commercial fisheries in southern Portugal, particularly deep water trawls and
longlines. The objective of this study was to determine demographic parameters
for this species, in order to determine how the current levels of fishing
mortality are affecting this population. Mortality and survivorship parameters
were estimated both by indirect empirical methods from life history parameters,
and from the trawl fisheries catch curves. An age-structured demographic model
was created, and analyzed with Leslie matrices, considering scenarios with and
without taking into account fishing mortality. The analysis was carried out
using both deterministic scenarios (considering the point estimates), and with
scenarios taking into account the uncertainty in the parameter estimation
(using random errors according to specific distributions). The stochastic
scenarios were simulated by Monte Carlo simulation, with each input parameter
randomly generated based on the previously assumed distributions. In general,
when only natural mortality was considered, the population rate of increase was
usually higher than 1. In the scenarios considering total mortality from the
trawl fisheries catch curves, the population rates of increase were usually
lower than 1, meaning that the population in those cases is declining. Matrix
elasticities were calculated. For the survivorship parameters, the elasticities
were higher for the younger age classes and tended to decrease for the older
ages, which is typical of the slower growing elasmobranch species. The results
presented in this paper provide insights on how commercial fisheries,
particularly trawls, are affecting this deep water shark species, and how
uncertainty in the life history parameters can affect the demographic models
estimations.
Cosandey-Godin, Aurelie (Dalhousie University); Wimmer,
Tonya (WWF-Canada, Halifax, NS, Canada); John H., Wang (NOAA-Kewalo Research
Facility, Honolulu, HI, United States); Worm, Boris (Dalhousie University,
Halifax, NS, Canada)
No Effect from Rare-Earth Metal Deterrent on
Shark Bycatch in a Commercial Pelagic Longline Trial
The indiscriminate capture of non-target organisms
(bycatch) in commercial fisheries is an issue of critical concern to the
sustainable development and conservation of marine resources. In the Northwest
Atlantic, blue sharks (Prionace glauca) comprise a significant proportion of
unwanted bycatch in the Canadian pelagic longline fleet targeting swordfish and
occasionally tuna. Minimizing the capture of these species is of interest to
the industry as well as conservation organizations. Several shark species have
been shown to be repulsed by the magnetic field generated by rare-earth
magnets. For this reason, magnetic deterrents have become a promising bycatch
solution on pelagic longlines, but controlled trials under commercial fishing
conditions are still lacking. In collaboration with the longline industry, a
total of 7 sets (6300 hooks) with three hook treatments: standard hooks, hooks
equipped with rare-earth alloys (Nd/Pr), and hooks with lead weights were
deployed in 2011 on the outer scotia Shelf, Nova Scotia. Results suggest that
rare-earth metals do not have any significant deterrent effect on the most
common shark bycatch species (blue, mako, and porbeagle) and as such are not a
practical bycatch mitigation option in the Canadian fishery. The inclusion of
all stakeholders in this study has proven valuable in improving the methodology
by operating under realistic commercial-scale conditions; we believe that this
is an effective way to conduct bycatch research at a regional level.
Davis, Brendal (Dalhousie University); Worm, Boris (Dalhousie
University, Canada)
The International Plan of Action for Sharks: How
does Canadas national plan measure up?
Various species of sharks, skates, and rays continue to
decline, demonstrating a greater need for effective conservation measures. In
1999 the Food and Agriculture Organization (FAO) developed comprehensive
guidelines in its International Plan of Action (IPOA- sharks ), which was
followed by corresponding national plans in some nations. Here we examine progress under Canadas
National Plan of Action for Sharks (NPOA-
sharks ), against its stated goals, against Australias NPOA, and against the
original FAO guidelines. For comprehensiveness, we also evaluate additional
management and conservation measures for sharks, as well as stakeholder input
from the first Atlantic Shark Forum. Although Canada is recognized as a leader
in shark management, it has largely failed to effectively adopt the FAOs
principles and guidelines. The plan notably lacks set timelines, priorities, or
action plans to mitigate threats to sharks, and contains no performance
indicators. Additionally, the plan neglects to identify priority species, or
engage stakeholders, and cannot be linked directly to management measures. To
advance the revision of this plan (as well as other NPOAs), we recommend a
stepwise process that includes (i) stakeholder engagement and development of a
shark assessment report (SAR) (ii) addressing of all IPOA objectives, while
prioritizing issues arising from the SAR (iii) implementations of actions,
targets, and timelines that are reviewed every four years. We also suggest key
policy items to advance Canadas role in shark conservation and management at
the national and regional level. These include actions to improve data
collection and research, management, education, as well as coordination with
stakeholders. If Canada aims to improve shark management and conservation,
major changes are needed to the existing NPOA. Likewise, the abovementioned
measures may help guide more proactive plans in nations that have not yet
established an NPOA.
Frazier, Bryan (South Carolina Department of Natural Resources);
Age and Growth of the Bonnethead, Sphyrna
tiburo, in the Coastal Atlantic Waters off the Southeastern United States
The
bonnethead is a
relatively small shark, reaching a maximum length of 150 cm. It occurs in the
western Atlantic Ocean from North
Carolina to Southern Brazil, including the Gulf of Mexico (Compagno 1984). The bonnethead is
placentally viviparous and unique among coastal sharks in the region, as its gestation
period lasts for only five months and parturition occurs in the early fall. Life history
characteristics have been well studied
in the Gulf of Mexico, where maximum ages for males and females are 8+ and 12+ years, respectively
(Parsons, 1993; Carlson and Parsons 1997). By contrast, comparatively little is known about bonnetheads
in the Atlantic
waters off the
southeastern United States, although recent survey data suggests that their life history could
differ from Gulf of Mexico bonnetheads. In South Carolina, where the majority of specimens were collected,
bonnetheads are
seasonally
present and females primarily inhabit estuarine waters while males primarily inhabit shallow coastal
waters. The objectives of this study were to (i) validate the periodicity of vertebral band pair
formation in the Atlantic waters off the southeastern United
States, (ii) characterize the age and growth of the bonnethead in the region, and (iii) investigate
whether clinal variations
in growth exists.
Data from previous works were utilized to compare growth parameters determined during the
current study with those conducted in other areas.
Within population variation between northern and southern Atlantic specimens were also examined. A variety of
growth models were fitted to age and size data and also compared against observed individual growth from
tag-recaptures in
order to
determine the model that best fit the population. These data were used to generate regionally specific
information on growth, maximum observed age, theoretical maximum age, and theoretical maximum length.
This study contributes
to the biological
knowledge of this species and provides parameters that are essential for stock assessment
purposes.
Harris, Lindsay (Florida Atlantic University);
Bedore, Christine; Kajiura, Stephen (Florida Atlantic University)
Bioelectric fields of elasmobranch prey
All aquatic organisms produce minute yet complex electric
fields around their body as a result of internal ion concentrations that differ
from those in the environment. Ion leakage across mucous membranes results in
greater electric field strengths around the mouth and gills where they are
modulated by opercular movements during respiration. The divergent electrical
properties of freshwater and saltwater present different challenges for
electroreceptive predators like elasmobranch fishes (sharks, skates, and rays)
that detect the bioelectric fields of their prey. This study employed an
electrophysiological technique to measure the voltage and frequency of electric
fields produced by various elasmobranch prey items in both fresh and saltwater.
Three marine invertebrates, eight marine fishes, and three freshwater fishes
representing a broad taxonomic range and lifestyle were chosen for this study.
Overall, the fishes produced a greater average voltage than the invertebrates
(marine fishes 134.15 μV; freshwater fishes 849.59 μV; invertebrates
16.8 μV). All fishes generated the greatest voltage near the mouth and
gills (marine average 113.0 μV, freshwater average 765.18 μV) and the
smallest voltage along the trunk and caudal peduncle (marine average 13.76
μV, freshwater average 41.18 μV). The amplitude of the bioelectric
potential did not correlate with size or mass of the prey items. The frequency
component ranged from 0.61 Hz at the mouth of the freshwater tiger oscar
Astronotus ocellatus to 11.1 Hz at the swimmerets of the marine shrimp Penaeus
spp. These frequencies fall within the range of detection for elasmobranchs
(<20 Hz). Decay of the electric field with distance was also measured, and
bioelectric potentials could be measured up to 5 cm away from the mouth of the
freshwater fishes, and 15 cm from the mouth of the marine fishes.
From these voltage data, the electric field gradient (μV/cm) was modeled to estimate from how far an elasmobranch could detect the electric
potential of a prey item. Marine elasmobranchs should be able to detect a
teleost prey item from 32-75 cm away based on an average electrosensitivity of
35 nV/cm. Sensitivity data are lacking for freshwater elasmobranchs so
detection distances of freshwater prey remain unknown, but are the subject of
ongoing research.
Holmes, Bonnie (University of Queensland);
Long-term movement patterns of satellite tagged
tiger sharks (Galeocerdo cuvier) in south eastern Australia
The tiger shark (Galeocerdo cuvier) is one of the highest
trophic order predators in Australias coastal marine
waters. Described as a tropical species, G. cuvier movements into southern
sub-tropical and warm temperate waters have previously been assumed to occur
seasonally in the austral summer. Determining movement patterns and habitat use
is vital for better understanding the role of tiger sharks in structuring
coastal communities. As a species potentially dangerous to bathers, it is also
important to understand when and where interactions with humans are likely to
occur. Pop-up archival (PAT) and Smart Positioning or Temperature Transmitting
(SPOT) satellite tags were used to investigate seasonal movement and site
fidelity of tiger sharks in southern Queensland and northern New South Wales. A
total of 12 tiger sharks were tagged between 2007–2011 across a range of
sizes, sexes and seasons. Preliminary results indicate that some large and
small tiger sharks of both sexes will remain in southern Queensland waters
during the cooler winter months. Depth profiles obtained from PAT tags
indicated maximum depths of over 1760 m, deeper than previously reported for
the species, with water temperatures as low as 5.9 degrees
Celsius. The greatest distance travelled was 1800 km, from Botany Bay NSW to New Caledonian waters after 48 days at liberty.
Notwithstanding this, the majority of individuals maintained some fidelity to
the coastal zone highlighting the importance of near-shore habitat. We
hypothesise that habitat utilisation is driven predominantly by prey
availability.
Kume, Gen (Nagasaki University); Furumitsu, Keisuke (Nagasaki
University, Nagasaki, 3, Japan); Yamaguchi, Atsuko (Nagasaki University,
Nagasaki, Japan)
Life history of fanray Platyrhina tangi in
Ariake Bay, Japan
Growth, reproduction and feeding habits of fanray
Platyrhina tangi were examined in Ariake Bay. Age determination was conducted
by vertebral centrum analysis using soft X-radiography. Annual band pair
deposition was determined by marginal increment and edge analyses. The von
Bertalanffy growth model best described the overall pattern of growth for both
males and females (males L = 455.2, k = 0.56, t0 = −1.09; females L =
555.8, k = 0.28, t0 = −1.77; L is the theoretical asymptotic total length
in mm, k is the growth rate coefficient and t0 is the theoretical time at zero
length). The observed maximum ages were 5 years for males and 12 years for
females. Females reached sexual
maturity at an older age and larger size than males [50% sexual maturity: male,
393 mm total length (TL) (2.1 years); female, 421 mm TL (2.9 years)]. The
present data support a distinct annual reproductive cycle for P. tangi.
Parturition occurred from August to November followed immediately by mating,
ovulation and fertilization. Mature females become pregnant every year, and the
gestation period is almost 1 year. Fertilized uterine eggs without macroscopic
embryonic development were present throughout the annual reproductive cycle,
indicating that the species utilizes embryonic diapause as its reproductive
strategy. Both reproductive tracts of females were functional, and fecundity
ranged from 1 to 12 with a mean of 6.0, increasing with TL. Of 334 stomach
specimens, 324 contained food and 10 (3.0%) were empty. Thirty-seven taxonom
levels of prey were identified. The most common prey was shrimp, followed by
fish and mysids. There were no differences in the composition of the diet
between sexes, but an ontogenetic dietary shift was observed. Trophic level
analysis revealed that trophic level increased with size; however, this species
is consistently a secondary consumer. Dental sexual dimorphism was also
observed. Specifically, mature males had much longer and sharper cusps than
females and immature males. Since males and females had similar diets, dental
sexual dimorphism may be related to their reproductive behaviour.
McPhie, Romney (Department of Fisheries and Oceans); King,
Jacquelynne (Department of Fisheries and Oceans, Canada)
Diel vertical migration of bluntnose sixgill
sharks (Hexanchus griseus) in the Strait of Georgia, British Columbia
Previous observations on the diel activity patterns of
bluntnose sixgill sharks (Hexanchus griseus) were most consistent with the
hypothesis that foraging activity is responsible for their diel patterns of
vertical movement. However, ecosystems vary with respect to physical processes
(e.g. mixing, stratification and the depth of thermocline) as well as food web
dynamics (e.g. prey abundance and availability). We used temporal depth and
temperature data collected from pop-up satellite tags to test the foraging
activity hypothesis for sixgills residing in the Strait of Georgia. Alternate
hypotheses that might explain diel vertical migration patterns include the
avoidance of predators and/or competitors, or thermoregulation. Our results
extend the spatial scale of observations made in the nearby ecosystem, Puget
Sound.
Pickard, Alexandria (Guy Harvey Research Institute,
Nova Southeastern University, FL 33004 USA); Wetherbee, Brad (Guy Harvey
Research Institute, Nova Southeastern University, FL, and the University of
Rhode Island, RI, USA); Nemeth, Richard; Kadison, Elizabeth; Blondeau, Jean
(University of the Virgin Islands, St. Thomas, Virgin Islands, USA); Shivji,
Mahmood (Guy Harvey Research Institute, Nova Southeastern University, FL 33004
USA)
Characterization of shark movements on a
mesophotic Caribbean coral reef and temporal association with fish spawning
aggregations
Fish spawning aggregations (FSA) are often composed of
hundreds to thousands of individuals and represent the primary source of annual
reproductive effort for many species. Migration of sexually mature adults from
home sites to spawning grounds for reproduction is predictable in location and
timing. Fish spawning aggregations may also play an important role in ecosystem
function. For example, grouper spawning aggregations can represent a huge
concentration of fish biomass, which fluctuates on a seasonal basis. As such,
they may represent a potentially important prey source for large predators,
including sharks. Moreover, their large-scale reproductive migrations connect
various habitats and local food webs within the larger ecosystem. This study
aims to determine how populations migrating to FSA sites function within the
ecosystem, by examining the relationship between movement patterns of apex
predators (sharks) and multi-grouper species at two FSA sites along the
southern shelf edge of St. Thomas, US Virgin Islands. We test the hypothesis
that increased shark presence will be detected at FSA sites during grouper
spawning seasons. To determine shark presence at spawning aggregations, three
species of sharks (tiger, lemon and Caribbean Reef) were tagged with acoustic
transmitters (VR13, 16). Their movements were monitored over five years using
an array of Vemco receivers (VR2) deployed at spawning sites and at locations
spanning a stretch of deep reef approximately 100 km in length. Receiver data
will indicate if shark frequency at spawning areas is correlated temporally
with grouper spawning seasonality, diurnality or species. Results will increase
knowledge of shark reliance on FSA sites and how they utilize the mesophotic
reef system as a whole, for habitat and prey.
Pompert, Joost (Falkland Islands Fisheries Department); Pierce,
Graham (Aberdeen University); Brickle, Paul (Falkland Islands Fisheries
Department,); Arkhipkin, Alexander (Falkland Island Fisheries Department)
Reproductive strategies of two species of skate
(Bathyraja macloviana and Bathyraja cousseauae) inhabiting the Falkland Islands
shelf; a comparison
The reproductive strategies for the Falkland skate,
Bathyraja macloviana and the joined-fin skate Bathyraja cousseauae from
specimens caught in waters around the Falkland Islands are presented. LM50 as
derived from reproductive organ development are compared with those derived
from maturity stages. For female B. macloviana these are 48.7-52.2cm Lt, for
males 46.9-47.6 cm Lt, for male B. cousseauae the values are 90.9-92.7cm Lt.
These LM50 values compare well with those derived from maturity stages and are
attained at a relatively large size of 75% and 77% of Lt-max respectively. The
fecundity of both species is low, at around 7 for B. macloviana and around 21
for B. cousseauae. Of all samples examined, one hermaphrodite B. cousseauae was
noted. Both species display
ontogenetic changes with depth, with juvenile B. macloviana present at and over
the shelf break, and all other size and maturity classes present mainly on the
shelf. Juvenile B. cousseauae are also mainly present at the shelf break, but
as specimens grow and mature they migrate to deeper water, returning to
shallower water to spawn on the shelf break. Both species also display spawning
seasonality, with B. macloviana spawning primarily in spring and summer months,
and B. cousseauae primarily spawning in winter and spring months. Energy investment into reproduction for
females of both species is shown by a clear increase in HSI with size, and a
decreasing HSI as the animal enters the reproductive phases at LM50, with
concomitant increases in GSI. Dimensions of egg capsules are presented, with
the mean capsule length (excluding horns) for B. macloviana 75.4mm, and for B.
cousseauae 125.9mm. The new life
history information on these two species discovered by this study improves the
understanding of the reproductive biology of these two species, and will help
with refining the stock management models. It will also assist with the study
of other species in the skate assemblage in the region.
Weideli, Ornella (University of Basel); Gruber,
Samuel (Bimini Biological Field Station, Miami, FL, United States); Stump,
Kristine (University of Miami, Miami, FL, United States); Chapman, Demian
(Stony Brook University, Stony Brook, NY, United States); Feldheim, Kevin (The
Field Museum, Chicago, IL, United States); Salzburger, Walter (University of
Basel, Basel, Switzerland)
Has resort related large-scale mangrove habitat
destruction resulted in a change of the prey community and therefore in a
dietary shift of nursery bound juvenile lemon sharks, Negaprion brevirostris (a
BACI study)?
Non-lethal eversion for collecting and sampling shark
stomach contents is a common method used in dietary studies. By also sampling
available prey communities the overlap between observed diet and prey
availability can be investigated. Recent studies have shown that sharks are
capable of foraging as selective predators, not simply feeding on the most
available prey, which makes dietary studies more interesting
and complex. The waters around Bimini, Bahamas (25 ̊44N, 79 ̊16W)
provide an ideal nursery location for juvenile
lemon sharks (Negaprion brevirostris). The near-shore nursery areas offer large
seagrass beds fringed by mangroves, a favorable habitat for a large number of
subtropical coastal organisms such as teleosts (e.g. juvenile reef fish) and
small invertebrates. However, large scal development has resulted in the
removal of shoreline mangroves (up to 50 %) and dredging of seagrass beds
(~750,000 m3). This has led to a drastic habitat alteration in one of the main
lemon shark nurseries. The aim of this study was to investigate whether this
anthropogenic habitat alteration has led to a change in the diet of nursery-bound
juvenile lemon sharks. Samples were collected in both the impacted nursery and
a nearby but undisturbed control nursery prior and post development, making it
possible to conduct a Before-After, Control-Impact (BACI) study. The current
dataset originates from two different time periods: before (year 2000-2003) and
after the development (year 2010-2011). The former data collection is
pre-development, and the later as a post-development subsample of the original
dataset. Post-development samples obtained for this study consist of 111 full
and 90 empty stomachs and a prey community collection of 9,920 individuals
(teleosts and invertebrates) weighting 152,694 grams. Prey community and
stomach contents of both sampling periods were identified to the lowest taxonomic
level, both visually and through DNA sequencing, and were then grouped into
families, enabling the comparison of post- and pre-development data using an
index of relative importance (%IRI). Dietary analyses of prey groups revealed
in both studies that teleosts dominated the diet by number, weight and
occurrence, followed by crustaceans as the most important invertebrate prey
group. Results indicate that post-development, juvenile lemon sharks were
feeding from lower number of available prey species with an increased level of
scavenging from anthropogenic sources.
Weng, Kevin (Pelagic Fisheries Research Program, U of Hawaii);
Comfort, Christina (University of Hawaii)
Habitat of a globally distributed deep water
shark, Hexanchus griseus, in Hawaii
Demersal and deepwater sharks have received less attention
than high profile epipelagic species, although their overlap with fisheries and
high vulnerability to overexploitation makes them high priority species for research and conservation. Hexanchus griseus may be a top
predator on most of the worlds continental shelves and slopes,
but we have limited understanding of its biology. It is found from the equator
to boreal zones, and from near the surface to almost 2000 m, deepening its
habitat towards the equator. In Hawaii the species has been observed from
submersibles and with baited cameras, and captured across a range of sizes from
juvenile to adult. Conventional and satellite tagging reveals that H. griseus
typically has high residency but makes occasional long distance movements.
Foraging behavior is dominated by strong diel vertical migrations that bring
the species up to 200 m at night, potentially into contact with deep reef and
epipelagic species.
Friday Poster 2 Session:
Elasmobranch Genetics & Morphology. Starting a 6:00 PM
Bernard, Andrea (Save Our Seas Shark Center USA
& Guy Harvey Research Institute); Feldheim, Kevin (The Field Museum of
Natural History, Pritzker Laboratory for Molecular Systematics and Evolution,
Chicago, IL, United States); Heithaus, Michael (Florida International
University, North Miami, FL, United States); Wintner, Sabine (KwaZulu-Natal
Sharks Board, N/A, South Africa); Wetherbee, Brad (University of Rhode Island,
Kingston, RI, United States); Shivji, Mahmood (Guy Harvey Research Institute
& Save Our Seas Shark Center, Dania Beach, FL, United States)
Population genetic structure and evolutionary
history of the tiger shark (Galeocerdo cuvier) on a global scale
The tiger shark (Galeocerdo cuvier) is a globally
distributed, migratory species inhabiting warm-temperate and tropical waters.
With their large size, generalist feeding habits and broad habitat distribution
ranging from coastal to pelagic environments, tiger sharks likely play an
important role as apex predators in marine ecosystems. Recent evidence
indicates over-exploitation and population decline of this species in some
regions. We report on the global population structure and evolutionary history
of tiger sharks inferred from a combination of 10 nuclear microsatellite loci
(n = 389 animals) and sequences of the mitochondrial control region (mtCR)
(1,068 bp; n = 349) and cytochrome oxidase I gene (642 bp; n = 152). Strong
genetic differentiation was detected among western Atlantic and Indo-Pacific
tiger sharks with all three sets of genetic markers, with limited inter-basin
mixing. However, some contrasting patterns of intra-basin structure were
detected across mitochondrial and nuclear markers, with mtCR sequences
generally indicating increased genetic partitioning within ocean basins. Tiger
sharks from the Indian and Pacific Ocean coasts of Australia were significantly
differentiated based on mtCR but not nuclear markers. Coalescent based analyses
and mtCR sequence diversity estimates were largely congruent and suggestive of
an Indo-Pacific origin for tiger sharks, with subsequent colonization of the
Atlantic Ocean during the mid to upper Pleistocene via dispersal around South
Africa. This work supports the assessment and management of tiger sharks from
the western Atlantic and Indo-Pacific separately, and points to the need for
further investigation of smaller-scale population structure within ocean
basins.
Casas, André
(Universidade de So Paulo); Intelizano, Wagner (Universidade Metropolitana de
Santos); Carvalho, Marcelo (Universidade de So Paulo)
Anatomical variation in the extrinsic eye
muscles of the Odontaspidade (Chondrichthyes: Lamniformes).
The family Odontaspididae is represented by the genera
Carcharias and Odontaspis and has been considered to be paraphyletic in
morphological and molecular studies. These results suggest that odontaspidid
morphology should be revised. The present study examined seven specimens of
this family (six Carcharias taurus, one Odontaspis noronhai) and two specimens
of Rhizoprionodonsp. (Carcharhiniformes), with the objective to describe and
understand morphological variation in their extrinsic eye muscles. Carcharias
taurus and Odontaspis noronhai present six extrinsic eyes muscles (rectus
dorsalis, rectus lateralis, rectus ventralis, rectus medialis, obliquus
dorsalis, and obliquus ventralis), therefore resembling the elasmobranch
general pattern. To precisely determine the morphology of the obliquus dorsalis
muscle in the examined species the trochlear nerve (IV) was followed from its
origin to its distal innervation. This procedure revealed variations in the
origin of the obliquus dorsalis when compared to the general pattern described
for other elasmobranchs. Two distinct conditions for its origin were found:
state (0), origin on nasal capsule dorsal to the origin of the obliquus
ventralis (present in Odontaspis noronhai, Alopidae, Lamnidae and in the great
majority of elasmobranchs described in the literature); and state (1), origin
on nasal capsule ventral to the origin of the obliquus ventralis (present in
Carcharias taurus and Rhizoprionodon sp.). This preliminary result suggests
that state (1) is independently derived in Carcharias taurus and Rhizoprionodon
sp. For a greater comprehension of the phylogenetic meaning of the variation in
the obliquus dorsalis in Carcharias taurus, additional lamniform and other
elasmobranch taxa must be examined.
Charvet, Patricia (SENAI / PR); Viana, Anderson
(Projeto Trygon)
Embryonic Stages of Development of Neotropical
Freshwater Stingrays (Potamotrygonidae)
Neotropical freshwater stingrays are highly valued as
ornamental fish and the trade is concentrated on neonate and juvenile specimens
due to size issues. Despite having these after birth life stages well known,
little information is available on the embryonic development of
potamotrygonids. In the present study over 500 embryos of potamotrygonid
species (mainly Plesiotrygon iwamae, Paratrygon aiereba, Heliotrygon rosai,
Potamotrygon leopoldi, P. scobina, P. motoro, P. orbignyi and P. signata) were
macroscopically analyzed, weighted and measured. Five main stages of
development were noted, each with specific morphological characteristics such
as disc and pectoral fins formation, gills development, pigmentation, disc
width size, weight and yolk sac proportion. The results were consistent for all
species studies until now and a specific embryonic development scale is
presented for this group. Some of the main features for each stage are
presented as follows. At the first stage gills are external, pectoral fins not
fused, there is no sign of pigmentation and the yolk sac weight corresponds to
approximately 90% of the embryo weight. The second stage has similar features,
however, pectoral fins are fused and yolk sac decreases to around 60% of the
embryo weight. At the third stage gills become internal and the yolk sac
corresponds to less than 50% of the embryo weight. The most significant changes
at stage four comprise beginning of the pigmentation process and a significant
reduction on the yolk sac proportion, corresponding now to around 15% of the
embryo weight. The fifth and last stage of development is widely known as near
term embryonic development, when pectoral fins are fully developed, gills are
internal, pigmentation patterns are well defined and the yolk sac proportion
drops down to less than 5% of the embryo weight. In some regions of the Amazon
basin where ornamental captures are carried out illegally, some fishermen
capture pregnant females, cause abortions and try to commercialize embryos at
stages of development four or five. This condemned practice leads to embryo
mortality in most cases, since only occasionally embryos at stage five might
survive if aborted. The existence of an embryo development scale for this group
of stingrays contributes to determine pregnancy development and provides data
for law enforcement agents to detect when illegally aborted embryos are
tentatively being commercialized.
Chiquillo, Kelcie (San Francisco State University);
Crow, Karen; Bravo, Nerieda (San Francisco State University, Canada); Ebert,
David (Moss Landing Marine Laboratories, Canada)
The secret of the Mermaid's Purse: A novel
reproductive strategy in two skates of the genus Raja
Skates (Rajiformes) are considered to be the most diverse
group of cartilaginous fishes and occur throughout the world, in benthic, sandy
habitats. Skates are classified as elasmobranchs, along with 350 other species
of cartilaginous fishes. The systematics of the Rajiformes remains contentious,
with multiple topologies inferred from various sources of data. Several studies
have called for a reorganization of the genus and therefore a reliable
phylogeny of the genus has not been proposed. The goal of this research is to
evaluate the phylogenetic affinities of skates within the genus Raja based on
molecular data from multiple mitochondrial DNA (mtDNA) loci-- 12S, 16S, and
COI. Previous studies focused on determining several Raja species, none have
addressed monophyly of the genus. Furthermore, none of these studies have
included the two species that exhibit the unique trait of having multiple
embryos per egg capsule: Raja Binoculata and Raja Pulchra. We propose a phylogenetic
hypothesis to infer the evolutionary history of multiple embryos per egg
capsule within this genus. We found that R. pulchra and R. binoculata are
sister taxa, and therefore we infer that the character of multiple embryos per
egg capsule has arisen once in evolution. We are currently investigating
fitness tradeoffs, such as differential survivorship and multiple paternity in
collaboration of the Aquarium of Bay in San Francisco, to determine whether
this reproductive strategy has a fitness advantage and whether it effects
conservation projects.
Delpiani, Gabriela (UNMdP, CONICET); Spath, Cecilia
(UNMdP, CONICET, Mar del Plata, Argentina); Figueroa, Daniel (UNMdP, Mar del
Plata)
Quantitative analysis of the denture of
Amblyraja doellojuradoi
Teeth morphology is an important tool widely used in
taxonomic, biological and fossil teeth studies of cartilaginous fishes.
Furthermore, the aim of the present study is the quantitative analysis of
Amblyraja doellojuradois dentition. This
species inhabits the Southwest Atlantic from 35o-56o S, between 51-642 m. The
number of rows of teeth in the upper and lower jaw of individuals of both sexes
was counted. In both jaws, the width and length of each tooth belonging to the
row selected from each area (commissural teeth, commissural region teeth,
symphysis region teeth, symphysis teeth) was measured. The total number of
teeth rows in the upper jaw ranged from 25-37, while in the lower jaw ranged
from 24-35. In the upper jaws both males and females showed significant differences
in the number of rows of teeth, as also in the lower (p= 0.005; p= 0.001
respectively). However, the number of rows in the upper and lower jaw for both
sexes was not significantly different (p= 0.154; p= 0.661 respectively).
Regarding he measurement of teeth, it was observed that the width of the teeth
for both sexes and both jaws is maintained constant along the rows and in all
areas. Variations were observed in regard to tooth length. In the upper jaw of
the female, the length of the teeth of the left commissural row is constant.
While in the remaining rows, the teeth are increasing its length from the
outside towards the inside of the jaw. In the lower jaw, the teeth of the
commissural rows (left and right) have a constant length, unlike the rest of
the rows that have progressively increased the length of teeth from the
outside, as mentioned above. In the upper jaw of the males was observed that
the length of the teeth is not constant, increasing its length from the
external to internal teeth. In the lower jaw of the males was found the same
pattern of variation of the length of the teeth seen in the lower jaw of
females. The importance of this work is to highlight the sexual heterodoncy and
the deterioration suffered by teeth. In the case of sexual heterodoncy, is
known to be a feature associated with the reduction of intraspecific
competition for food and with the bite during reproduction. Finally, in the
second case emphasized the importance of the replacement of older and damaged
teeth in elasmobranchs.
Gonzalez-Jurado, Dom (UCLA);
Anatomical, Histological, and Molecular
Characterization of the Venom of Squalus acanthias and Heterodontus francisci
Chondrichthyian fishes are now known to include many
venomous taxa, but most of what is known about the venom molecules and delivery
apparatuses in this group comes from studies of the batoids. The distribution
pattern and content of venoms found in either the chimaeras or sharks have
never been documented and remains poorly understood. Within sharks the
taxonomic families Squalidae, Etmopteridae, and Heterodontidae are known to
possess fin spines that could be potentially venomous. Here, histological
examination of fin spine tissues and basic biochemical and toxicological
analyses of fin spine extracts from several specimens of Squalus acanthias and
Heterodontus francisci are used to both confirm the presence of and provide a
basic description of the venom in these groups.
Gunn, Theresa (Florida Atlantic University); Cave, Eloise;
Bedore, Christine (Florida Atlantic University,); Kerstetter, David (Nova
Southeastern University, Canada); Kajiura, Stephen (Florida Atlantic
University)
Sexual Dimorphism in the Dentition of Basal
Vertebrates
Elasmobranch fishes are among a small group of vertebrates
that use their mouth to bite their mate during courtship and copulation.
Because the teeth of males are under selective pressure to facilitate both
feeding and grasping of the females, there exists the potential for conflicting
selective demands on the tooth morphology, where the tooth shape optimal for
one behavior may be suboptimal for the other. Various elasmobranch species have
been documented to exhibit sexual dimorphisms in tooth morphology with males
typically possessing more cuspidate teeth, presumably to facilitate grasping
the female during mating. Male Atlantic stingrays (Dasyatis sabina) demonstrate
seasonally dynamic changes in dentition, from molariform teeth during the
non-mating season to cuspidate teeth during the mating season. This seasonal
change in tooth shape is documented for only a single species so it remains
unknown whether this is a widespread phenomenon. Pelagic stingrays
(Pteroplatytrygon violacea) are in the same family (Dasyatidae) as Atlantic
stingrays but feed on teleost and squid prey which present similar demands on
the male tooth morphology as the slippery body of their female mates. If the
tooth morphology of pelagic stingrays is sexually dynamic and males undergo a
seasonal change in tooth shape, it suggests that dynamic teeth are likely
widespread throughout the batoids. Pelagic stingray jaws were collected monthly
from commercial fisherman for a full year. the number of tooth files and rows
did not differ between the sexes and ranged from 20-35 tooth rows and 5-10
tooth files in both upper and lower jaws. Upper jaw symphyseal teeth were
extracted for shape analysis, Qualitative differences in tooth shape were
observed between males and females throughout the year, and males demonstrated
different tooth shapes between mating and non-mating seasons. Male Pelagic
stingray teeth were more strongly cuspidate than female teeth especially late
in the mating season (April) when the teeth have rotated to the outermost
functional position. Male teeth from the non-mating season (November) showed a
more rounded triangular shape. A Procrustes superimposition with relative warp
analysis was employed to quantify the differences between the sexes and between
mating and non-mating seasons. The observation that male tooth morphology
changes seasonally, even in a piscivorous species, indicates that this is a
widespread phenomenon.
Oddone, Maria Cristina (Universidade Federal do Rio
Grande); Bianchini, Adalto (Universidade Federal do Rio Grande)
Inferences on in situ egg-laying behavior in
genus Sympterygia from the Southwestern Atlantic Ocean and implications on
embryonic development
Oocyte encapsulation is a fundamental process that was
conserved in Chondrichthyes after the evolutionary divergence in so diverse and
contrasting reproductive modes. Rajoids are strictly oviparous producing
substantially complex egg capsules for embryos protection during development.
Genus Sympterygia is endemic to the Southern Atlantic and Pacific South
American shelves. Morphology of its egg capsule is rather particular because of
the presence of extremely long tendrils instead of regular posterior horns, as
in other skates. Females fix the sticky tendril ends to marine debris and
immediately swim around them to firmly entangle one paired egg capsules after
the other, forming a capsule nest. However, the reproductive behavior (as well as the embryonic
development) of the genus has been poorly studied. In October 2009, a sampling
program for skate egg capsules was started to quantify the occurrence and
diversity at Cassino Beach, a 220 km long beach in Southern Brazil. Every week,
dry and embryo-bearing egg capsules have been collected; the latter have been
transferred and kept at the Animal Care Room of the Physiological Sciences
Building (FURG). Egg capsules of Rioraja agassizi (monospecific genus) were the
most abundant, followed by those of Sympterygia acuta and S. bonapartei.
Psammobatis and Dipturus were scarcely represented. Nests of S. acuta and S.
bonapartei bearing live embryos have been often found washed ashore over the
Cassino Beach after storms or during intense windy days. They are complex
structures representing a microhabitat for a significant number of
invertebrates [Mollusca (Mytilidae, Donacidae and Mactridae); Crustacea
(Cirripedia and Caprellidae); Cnidaria (Campanulariidae)], macrophytes
(Cyperaceae), macroalgae (Ulvaceae) and even a temporary substrate for the
development of vertebrate eggs [Pisces (Atherinopsidae: Odontesthes sp.)]. Egg
capsules in the nest assume the aspect of flowers in a bouquet, with most
capsules oriented vertically in the water column. This was proved to be more
advantageous for the developing embryos than capsules of other genera laying
horizontally on the sea floor. In the nests, more proper capsule ventilation
and consequently better oxygen influx into the capsules occur. Parental care is
uncommon among chondrichthyans, but the egg-laying behavior described for
Sympterygia may be considered as such. A similar degree of complexity in the
reproductive behavior has only been reported in oviparous sharks.
Seret, Bernard (Institut de Recherche pour le Dveloppement);
Deep-sea sharks from La Reunion (SW Indian
Ocean)
Two research programs are currently carried out at La
Reunion Island (south-western Indian Ocean). One concerns the evaluation of the
deep-sea resources and the other program, BIOLAVE, deals with the impact of the
recent volcanic eruptions on the marine life. In the frame of these programs,
deep-sea elasmobranchs have been collected. Preliminary results are presented,
with a focus on the taxonomic status of Squalus species, commonly caught in the
deep-sea around this volcanic island.
Testerman, Christine (Save Our Seas Shark Center USA
& Guy Harvey Research Institute); Wintner, Sabine (University of KwaZulu-Natal,
Canada); McAuley, Rory (Western Australia Fisheries and Marine Research
Laboratories, Canada); Cartamil, Dan (Scripps Institute of Oceanography);
Shivji, Mahmood (Save Our Seas Shark Center USA & Guy Harvey Research
Institute)
Global Population Genetic Analysis of the Smooth
Hammerhead Shark (Sphyrna zygaena)
The smooth hammerhead (Sphyrna zygaena) is a globally
distributed shark frequently caught as bycatch and in fisheries, and its fins
are valued in the international fin trade. Despite its wide distribution and importance in fisheries,
published information on its population dynamics is scarce. We evaluated the
global population genetic structure and demographics of S. zygaena using
complete mitochondrial control region sequences (1,090 nucleotides) and 19
nuclear microsatellite loci. Our genetic assessment is based on a widely
distributed set of 397 samples from the North and South Atlantic, northern,
central and southern regions of the eastern Pacific, and the southwest Indian
and western Pacific Oceans. The mitochondrial sequence and microsatellite-based
findings were generally concordant, revealing strong genetic partitioning
between samples from the Atlantic and Indo-Pacific, and shallower but
statistically significant genetic structuring within oceanic basins. As coastal
nursery areas have been reported for this species, we also investigated the
extent of female natal site philopatry and male mediated gene flow using
mixed-marker analyses. Statistical analyses of genetic diversity in S. zygaena
are also providing insight into current and historical population trends that
may be informative for conservation and fishery management efforts.
Testerman, Christine (Save Our Seas Shark Center USA
& Guy Harvey Research Institute);
Brunnschweiler, Juerg (ETH Zurich); Gulak, Simon
(Southeast Fisheries ScienceCenter,
National Marine Fisheries Service/NOAA); Werry, Jonathan
(Griffith University, Canada);
Jabado, Rima (United Arab Emirates University); Jones,
Catherine (University of Aberdeen); Shivji, Mahmood (Save Our Seas Shark Center
USA & Guy Harvey Research Institute)
Global Population Genetic Structure and
Parentage Analysis of the Bull Shark (Carcharhinus leucas)
Population structure, demographic trends and mating system
biology are important information components of national and international
management and conservation efforts. The bull shark (Carcharhinus leucas) is a
globally distributed, large coastal shark that occurs in marine, estuarine and
freshwater habitats. It has been assessed as near threatened by the IUCN, is
caught in recreational and commercial fisheries throughout its range, and shows
evidence of recent declines in the Gulf of Mexico. Recent reports have provided
evidence of strong geographic structuring between northern and southern
populations of C. leucas in the western Atlantic at the maternally inherited
mitochondrial control region locus, but no structure within the western
Atlantic at 5 nuclear microsatellite loci. We expanded on this study by
evaluating the global population genetic structure of C. leucas based on 490
samples from the central western Atlantic (northern Gulf of Mexico and US
Atlantic coast) and the Indo-west Pacific (South Africa, Persian Gulf, Arabian
Sea, Indonesia, eastern and western Australia, and Fiji) using twelve nuclear
microsatellite loci. We also genotyped 4 individuals from the eastern Pacific.
The microsatellite data revealed strong geographic partitioning between samples
from the Atlantic and Indo-Pacific and shallow but statistically significant
genetic structuring within oceanic basins. We present statistical analyses of
genetic diversity that provide insight into current and historical population
trends. Finally, parentage analysis of 2 litters (12 pups each) suggests that
the species may be genetically polyandrous.
Tomita, Taketeru (Hokkaido University Museum);
Sato, Keiichi (Okinawa Churaumi Aquarium, Motobu, 1, Japan); Suda, Kenta;
Kawauchi, Junro (Hokkaido University, Hakodate, Japan); Nakaya, Kazuhiro
(Hokkaido University, Hakodate, 4, Japan)
Feeding of the megamouth shark (Pisces:
Lamniformes: Megachasmidae) predicted by its hyoid arch: A biomechanical
approach
Studies of the megamouth shark, one of three planktivorous
sharks, can provide information about their evolutionary history. Megamouth
shark feeding has never been observed in life animals, but two alternative
hypotheses on biomechanics suggest either feeding, i.e., ram feeding or suction
feeding. In this study, the second moment of area of the ceratohyal cartilages,
which is an indicator of the flexural stiffness of the cartilages, is
calculated for 21 species of ram- and suction-feeding sharks using computed
tomography. The results indicate that suction-feeding sharks have ceratohyal
cartilages with a larger second moment of area than ram-feeding sharks. The
result also indicates that the ram–suction index, which is an indicator
of relative contribution of ram and suction behavior, is also correlated with
the second moment of area of the ceratohyal. Considering that large bending
stresses are expected to be applied to the ceratohyal cartilage during suction,
the larger second moment of area of the ceratohyal of suction-feeding sharks
can be interpreted as an adaptation for suction feeding. Based on the small
second moment of area of the ceratohyal cartilage of the megamouth shark, the
feeding mode of the megamouth shark is considered to be ram feeding, similar to
the planktivorous basking shark. From these results, an evolutionary scenario
of feeding mechanics of three species of planktivorous sharks can be suggested.
In this scenario, the planktivorous whale shark evolved ram feeding from a
benthic suction-feeding ancestor. Ram feeding in the planktivorous megamouth
shark and the basking shark evolved from ram feeding swimming-type ancestors
and that both developed their unique filtering system to capture small-sized
prey.
Velez Zuazo, Ximena (University of Puerto Rico);
Alfaro Shigueto, Joanna; Mangel, Jeffrey (ProDelphinus, Canada); Papa,
Riccardo; Agnarsson, Ingi (University of Puerto Rico)
What barcoding is revealing about the shark
fishery in Peru
Many sharks and rays are globally threatened as a result
of overfishing and bycatch. Currently, there is a growing interest in
sustainable conservation of sharks but important gaps in knowledge hinder
decision-making at the government level including a lack of basic knowledge of
the diversity of species targeted as well as incidentally captured by comercial
fisheries. In Peru, in the
southeast Pacific, the small-scale fisheries comprise ca. 10,000 vessels and,
for most elasmobranchs species, it goes largely unregulated and
unmonitored. Moreover, for the
elasmobranchs fisheries, insufficient monitoring of landings coupled with
limited taxonomic identifications have resulted in a poor understanding of the
diversity of species caught in Peruvian waters. Molecular analyses, particularly the use of a genetic
barcode approach, can play an important role in improving our knowledge of the
diversity of elasmobranchs species occupying the marine habitats of Peru and
captured by the small-scale fisheries.
We analyzed samples collected from six ports along the coast of Peru
between 2004 and 2009. We successfully
amplified 715bp of the cytochrome oxidase I region of the mitochondrial DNA and
identified 110 specimens at the species level. Nine species of sharks were identified. In many cases
landed specimens had been misidentified. In port, the smooth hammerhead
(Sphyrna zygaena) was identified correctly every time, the blue shark (Prionace
glauca) was correctly identified 86% of the time and the shortfin mako ( Isurus
oxyrinchus ) 66% of the time. For other specimens with a
non-informative common name (i.e. shark), molecular identification clarified
the species. Interestingly, all
samples from thresher shark were identified as pelagic thresher ( Alopias
pelagicus ) although in Peru the common thresher (A. vulpinus) is the
species reported as more common
and commercially important. We identified one specimen of the dusky shark
(Carcharhinus obscurus) which represents a new species report for Peru. Of the
nine sharks species identified, five are considered a threatened by the IUCN
Red List. This study represents the first large-scale initiative to barcode
Peruvian marine species and generated a molecular-based taxonomic list of
elasmobranches targeted by fisheries in Peru.
Wyffels, Jennifer (Daemen College); McLaughlin,
Donna; Morrissey, John (Sweet Briar College)
Scyliorhinus retifer egg jelly liquefaction
Upon oviposition, the eggs of oviparous elasmobranchs are
enveloped in three layers of egg white or jelly, liquid, mucoid and solid.
Proximal to the ovum is a liquid jelly contained within the chalaziferous
chamber. This chamber is surrounded by a viscous mucoid jelly. The matrix transitions
from mucoid to solid with increasing distance from the yolk mass. The solid
jelly occludes respiratory slits, openings in the egg case that allow seawater
circulation. During embryonic development, the chalaziferous chamber is
compromised as the mucoid jelly surrounding it liquefies. Liquefaction
continues radially from the mucoid to solid jelly until eclosion, when seawater
flows freely through the respiratory slits. The mechanism of liquefaction is
not understood but may be the result of secretions from an embryonic hatching
gland. Embryonic development for Scyliorhinus retifer was divided into 6 broad
stages using egg jelly condition and total protein concentration of the liquid
jelly. Protein concentration and volume of liquid jelly present within the egg
case increased concomitantly during liquefaction. Liquid egg jelly begins as a
clear fluid that turns yellow and increases in color intensity before becoming
cloudy near eclosion. Liquid jelly samples have less than 1 mg/ml of total
protein at oviposition. At or near the time of eclosion the liquid jelly has
more than 6 mg/ml of total protein. Protein and glycoprotein profiles for each
stage of development were compared using SDS-PAGE. A bioassay revealed activity
in the liquid jelly during stages 3, 4 and 5. A range of 0.3-2 mg of protein
was liberated per mg of solid jelly liquefied. The ability of 11 enzymes,
lysozyme, proteinase k, alpha amylase, trypsin, hyaluronidase, pepsin, papain,
collagenase, elastase, alcalase and amyloglucosidase, to liquefy solid egg
jelly was tested. Papain successfully liquefied solid egg jelly. Minor protein
and glycoprotein fragments were liberated using the other enzymes.
Henning 201, Saturday 9 AM; Chair Mamood Shivji;
Elasmobranch Genetics 1.
Kacev, David (SDSU); Hyde, John (Southwest Fisheries Science
Center); Lewison, Rebecca; Bohonak, Andrew (SDSU)
Using Genetics in a Mark-Recapture Framework to
Estimate Population Size of Data Poor Elasmobranchs
Accurate estimation of the size of wild populations is
critical for effective management, but incredibly difficult in pelagic
ecosystems. Traditional population assessments have relied upon fisheries catch
records to generate CPUE trends, however this is difficult for non-target
species where data can be very sparse. In this study, we developed a model
using population genetic data in a mark-recapture framework to generate a rough
estimate of population size. We simulated data for 16 microsatellite loci using
average allelic richness and allele distributions drawn from a wild population
of short fin mako sharks. We then bred these individuals by choosing two
at random and randomly selecting one allele per locus
from each to create an offspring genotype. From each paring we generated one to
four offspring based on litter sizes found in the literature. We thus created
an f1 generation based on 10 years of the model run. We sampled the genotypes
of the f1 generation and used these data to reconstruct the putative parental
genotypes, which could then be compared to known adults, and assigned each to
its putative parents. The first time an offspring was assigned to a putative
parent, it was considered a mark on that parent, and each subsequent assignment
of an offspring to that parent was considered a recapture. These mark-recapture
data were used in a Jolly-Seber model to generate an estimate of the putative
adult population, which could then be compared to the actual adult population
size to assess the utility of this method for population size estimation. We
then tested this framework using actual mako shark population genetic data.
Phillips, Nicole (Murdoch University); Chaplin,
Jennifer; Morgan, David (Murdoch University, Murdoch, WA, Australia); Peverell,
Stirling (Queensland Department of Primary Industries and Fisheries, Cairns,
WA, Australia)
Stock structure in the Indo-West Pacific Pristis
sawfishes: the importance of habitat use in the evolution of sex-biased
dispersal
A number of elasmobranchs across different families
exhibit sex-biased dispersal. However, the selective pressures that favor the
evolution of sex-biased dispersal in elasmobranchs are not well understood and
sex-biased dispersal has been assessed in too few species for a clear
pattern(s) to emerge. This study provides the first evidence of sex-biased
dispersal in sawfishes and demonstrates how such dispersal may vary with
habitat usage in Indo-West Pacific species. The Freshwater Sawfish, Pristis
microdon, which utilizes freshwater rivers as juveniles and marine/estuarine
waters as adults, was found to have male-biased dispersal in Australian waters.
In contrast, P. clavata and P. zijsron, which spend their entire lives in
marine and/or estuarine waters, are genetically structured in northern
Australian waters. The use of freshwater rivers as juveniles by P. microdon
suggests that the evolutionary history of this species in Australian waters was
potentially very different to those for P. clavata and P. zijsron and may have
influenced the evolution of sex-biased dispersal in the former, but not the latter,
species.
McVeigh, Doreen (Hood College);
Genetic Analysis of Populations of the Cownose
Ray, Rhinoptera bonasus, in the Chesapeake Bay and Gulf of Mexico.
Cownose rays, Rhinoptera bonasus, are elasmobranchs found
in the Western Atlantic from Brazil to Massachusetts. In the spring and early
summer, large schools of rays migrate into the Chesapeake Bay o forage. The
rays also utilize the Chesapeake Bay as a nursery for young-of-the-year pups
and a breeding ground. During the summer, cownose rays migrate throughout the
polyhaline portion of the Bay, but it is not currently known if these subgroups
of animals are genetically isolated. In this study, we analyzed DNA sequence
variation from portions of two variable mitochondrial genes, cytochrome b and cytochrome
c oxidase I, in samples collected from two sites in the Chesapeake Bay (St.
George Island, MD and Reedville, VA) and from Tampa Bay, FL. Preliminary
results indicate that there is a statistically significant difference in the
distribution (p < 0.05) of haplotypes between the two Chesapeake Bay
populations as well as a difference between Chesapeake and Tampa Bay
populations. Florida and Reedville share a haplotype that is present in
substantial frequencies (34% and 23%, respectively); this haplotype is absent
from the St. George Island population. These results suggest that the two
Chesapeake locations attract different southern source populations each summer.
Newby, Jennifer (Grice Marine Laboratory, College
of Charleston); Shedlock, Andrew (College of Charleston)
An examination of population genetic and social
structure in the spotted eagle ray (Aetobatus narinari) found seasonally off
coastal Sarasota, FL
Recent global declines in chondrichthyan populations have
risen as a major concern due to amplified pressure from fisheries. The spotted
eagle ray, Aetobatus narinari , is a cosmopolitan myliobatoid recognized as
near-threatened by the World Conservation Union however is not protected in
U.S. federal waters. A decreasing population trend, K-selected life history and
primarily inshore, coastal habitat endangers this species susceptible to
over-exploitation by targeted fisheries, drift netting, and capture as bycatch.
Since 2009 large seasonal aggregations have been observed in the Gulf waters of
Sarasota, FL. Modest ecological data is available for A. narinari but almost no
studies of fine-scale genetic structure exist. We are presently investigating
the molecular ecology of this A. narinari population using fin clips from
individuals sampled non-invasively across the region through the Mote Marine
Lab, Sarasota, FL, from April through November 2011. Genotypes of allele
frequencies for 9 independent eagle-ray-specifi microsatellite loci are being
employed currently to elucidate the population genetic structure and social
structure of eastern Gulf of Mexico (GOM) A. narinari. Standard tests for
Hardy-Weinberg Equilibrium, null alleles and linkage disequilibrium as well as
statistically significant patterns of geographic structure, direction and scale
of gene flow, and kinship among possible parent-offspring associations will be
discussed based on ecological, demographic and genetic data available.
Synthesis of baseline molecular data from the present study in the eastern GOM
and comparison to subpopulations in the Central Atlantic is expected to advance
our global understanding of A. narinari vulnerabilities in this region.
Bernard, Andrea (Save Our Seas Shark Center USA
& Guy Harvey Research Institute); Horn, Rebekah (1Save Our Seas Shark
Center USA & Guy Harvey Research Institute, Dania Beach, FL, United
States); Chapman, Demian (School of Marine and Atmospheric Science &
Institute for Ocean Conservation Science, Stony Brook, NY, United States);
Feldheim, Kevin (The Field Museum of Natural History, Pritzker Laboratory for
Molecular Systematics and Evolution, Chicago, IL, United States); Brooks, Edd
(Shark Research and Conservation Program, N/A, Bahamas); Gore, Mauvis (Marine
Conservation International, N/A, United Kingdom); Shivji, Mahmood (Save Our
Seas Shark Center USA & Guy Harvey Research Institute, Dania Beach, FL,
United States)
The genetic population structure of the
Caribbean reef shark (Carcharhinus perezi)
Ecological and community differences have been noted
across coral reef ecosystems with varying levels of anthropogenic intrusion,
with striking declines of apex predator densities documented where human
presence has historically been the highest. Within western Atlantic waters, one
of the most commo predators inhabiting coral reef ecosystems is the Caribbean
reef shark (Carcharhinus perezi). Given the vulnerability of this species to
fisheries and its potentially important ecological role as an apex predator, we
assessed the overall genetic diversity and connectivity across its tropical
western Atlantic distribution using both nuclear and mitochondrial DNA.
Caribbean reef sharks demonstrated extremely low levels of genetic diversity
across all surveyed loci relative to all other shark species analyzed to date,
which may be due to a recent evolutionary origin. Nevertheless, nuclear
microsatellite loci revealed population structure between Brazilian sites and
populations from The Bahamas and Caribbean Sea (FST > 0.0182; P 0.05). In contrast, concatenated
mitochondrial and mitochondrial/nuclear sequences revealed low but significant
genetic differentiation across most of the surveyed locations. These patterns
may reflect either historical patterns of dispersal or contrasting patterns of
movement between male and female sharks. Although tagging and tracking data
suggest these animals typically exhibit strong site attachment, our study
reveals complex population structure with evidence supporting contemporary long
distance mixing, at least by males, which should be incorporated into management
plans for this species.
Bolao Martnez, Nataly (Universidad Nacional Autnoma de
Mxico); Daz Jaimes, Pndaro (Universidad Nacional Autnoma de Mxico); Uribe
Alcocer, Manuel (Universidad Nacional Autnoma de Mxico); Galvan Magaa,
Felipe (Centro Interdisciplinario de Ciencias Marinas)
Philogeography and population genetics of the
hammerhead shark Sphyrna zygaena in the Oriental Pacific Ocean
Sphyrna zygaena lives in costal a pelagic zones and it is
usually found in tropical and subtropical areas including the Mediterranean Sea
(Compagno, 1984; Castro, 1983). In te Oriental Pacific Ocean its distributed
along the occidental coasts of Baja California, Golfo de California, Islas
Galpagos, Panama and Patagonia. It presents a discontinues distribution in the
mexican Pacific and Centralamerica. It is the most important species in
fisheries. It is possible that due to its distribution in the Pacific two
populations might be coexisting one in the Nothern Hemisphere and a second in
the South. By using molecular markers we pretend to determine if there is a
genetic flux between the two populations. If this flux do exist might be
limited or might not exist. In this case we will be having two discrete
populations therefore our main goals are: 1) to evaluate the genetic structure
of S. zygaena all along the
Oriental Pacific; 2) to determine its genetic variability using both
mitochondrial and nuclear markers and 3) to define a philogeographic pattern.
We have obtained 376 biopsys between Baja California Sur, Nayarit, Colima, and
Chiapas in Mexico; from Ecuador and Chile. Until know we have 136 analyzed sequences with D- loop
(Primer SPH_F: ACCGGTTTTTGTACGTCAGT), we have found 7 haplotypes. Of this 7
haplotypes we found 5 in Chile population in which three of them are exclusive
of this population. For the Mexican population found one exclusive and for the
Ecuador population we found 3 haplotypes and 1 exclusive. Nucleotidic and
haplotypic diversity were calculated Hd:0.60 and :0.001. To determine de
genetic flux between the two apparent
populations FST values were calculated (FST: 0.87) this indicates that there
are genetic differences between North and South populations but we have not
found yet differences among groups (North = Mexico (B.C.S, Coliman and Nayarit)
and South = Chile and Ecuador (Manta and Santa Rosa)).
Galvn-Tirado, Carolina (Posgrado en Ciencias del Mar y
Limnologa - UNAM); Daz-Jaimes, Pndaro (Instituto de Ciencias del Mar y
Limnologa - UNAM, Mexico, Mexico); Garca de Len, Francisco Javier
(Laboratorio de Gentica para la Conservacin, Centro de Investigaciones
Biolgicas del Noroeste (CIBNOR), La Paz, Mexico); Galvn-Magaa, Felipe
(Centro Interdisciplinario de Ciencias Marinas (CICIMAR), La Paz, Mexico);
Uribe-Alcocer, Manuel (Instituto de Ciencias del Mar y Limnologa - UNAM,
Mexico, Mexico)
Genetic differentiation of silky shark
(Carcharhinus falciformis) populations in the Pacific Ocean
The population genetic structure of the silky shark
Carcharhinus falciformis in the Pacific Ocean was studied using analysis of the
mtDNA control region. A 732 bp fragment was sequenced in 353 silky shar
individuals; analysis provided 14 haplotypes. Mean haplotype (0.48 0.03) and
nucleotide diversity (0.0009 0.00008) were unusually low for pelagic species.
The AMOVA analysis comparing Western and Eastern regions was at a low but
significant level of variance associated with differences between groups
(ΦCT = 0.0199, P = 0.008). We present the first population genetic study
of the silky shark in the Pacific and provide evidence that there are Eastern
and Western Pacific populations. Even thought, the significance on the levels
of population subdivision found, it is hard definitively to reject the hypothesis
of panmixia because of the small differences registered owing to the low levels
of mtDNA genetic variation. Based on our results and on the levels of
population exploitation, we suggest evaluating the adoption of a two-stock
management strategy to sustain the long-term use of this resource.
Gray, Teagen (Save Our Seas Shark Center USA and Guy Harvey
Research Institute, Nova Southeastern University, FL USA 33004); Bernard,
Andrea (Save Our Seas Shark Center USA and Guy Harvey Research Institute, Nova
Southeastern University, FL USA 33004); Clarke, S. (Oceanic Fisheries
Programme, Secretariat of the Pacific Community, BPD5 CEDEX, Noumea 98848, New
Caledonia); Chapman, D. (School of Marine and Atmospheric Sciences, Stony Brook
University, NY, USA); McAuley, R. (Department of Fisheries, Government of
Western Australia, Hillarys, WA, Australia); Shivji, M.S. (Save Our Seas Shark
Center USA and Guy Harvey Research Institute, Nova Southeastern University, FL
USA 33004)
Global phylogeography of the dusky shark (Carcharinus
obscurus) based on nuclear
microsatellite DNA analysis: delineation of
genetic stocks and the geographic sourcing of shark fins from commercial
markets.
The dusky shark, Carcharinus obscurus, is a globally
distributed, coastal- pelagic species subject to an apparent high level of
exploitation. The International Union for the Conservation of Nature (IUCN)
lists this species as Vulnerable globally, and Endangered within western North Atlantic and
Gulf of Mexico waters due to an over 80% decline
in this region, with no evidence of population recovery. The extensive
exploitation of dusky sharks may partly be attributed to the high market value
of its fins, but the contribution of individual dusky shark stocks to the fin
markets is unknown. This knowledge would be helpful to detect if specific
stocks are experiencing disproportionate levels of exploitation. Due to its
susceptibility to overfishing, current dire conservation status and need for
additional information on its population dynamics, we analyzed the genetic
population structure and genetic diversity of the dusky shark (n = 301) across
10 globally distributed locations utilizing 10 nuclear microsatellite loci.
Surprisingly, dusky sharks showed similar allelic richness and gene diversity (A=10.5-11.4;
H e = 0.64-0.66) across all populations despite the more severe IUCN
classification and a history of severe population decline in the western North
Atlantic. The microsatellite marker analyses support previously published mtDNA
work, identifying a strong divergence among Atlantic and Indo-Pacific samples (
F ST = 0.01-0.15; P <0.05). Overall, microsatellite marker results indicate
the presence of three genetically discrete management units for dusky sharks,
due to the significant genetic differentiation found between the western North
Atlantic, South African, and Australian collections and the low frequency of
migrant exchange between these populations. Additionally, these nuclear microsatellite-defined, discrete
management units provide a method for the assignment of market derived fins to
their population of origin with the use of genetic assignment techniques,
including Bayesian multi-clustering methods (Structure) and principal
coordinate analysis. Using these sourcing techniques, 15 of 21 market fins
analyzed were found to have likely originated from the highly endangered
western North Atlantic dusky shark population, supporting the need for more
urgent conservation measures within this region.
Testerman, Christine (Save Our Seas Shark Center USA
& Guy Harvey Research Institute); Fitzpatrick, Sean; Prodhl, Paulo
(Queen's University, Canada); Simpfendorfer, Colin(James Cook University);
Shivji, Mahmood (Save Our Seas Shark Center USA & Guy Harvey Research
Institute)
Global Phylogeography and Mating System Analysis
of the Great Hammerhead Shark (Sphyrna mokarran)
The population status of the great hammerhead shark
(Sphyrna mokarran ) worldwide is of management and conservation interest due to
its high bycatch mortality and high market value fins. We evaluated the
population genetic structure of S. mokarran based on samples from the central
western Atlantic (US Atlantic, Gulf of Mexico and Caribbean), Indian Ocean (Red
Sea, Persian Gulf and western Australia) and south western Pacific (eastern
Australia) using complete mitochondrial control region sequences (n=277) and
twelve nuclear microsatellite loci (n=286). The population structure results
based on mitochondrial and microsatellite markers were concordant, revealing
strong geographic partitioning between samples from the central western
Atlantic and Australia. We found shallow but statistically significant genetic
structuring within oceanic basins, albeit with some differences between the two
marker types in fine scale patterns involving Red Sea and Persian Gulf samples.
Standard molecular diversity indices and coalescent analyses suggest that the
species originated in the western Pacific with subsequent radiation into the
Indian and Atlantic oceans. We also conducted parentage analysis of four
complete litters (litter sizes n=55; n=23, n=20, n=19) and one partial litter
(n=6) using the nuclear microsatellite markers. The parentage analysis showed
multiple paternity in all 5 litters with a range of 2- 6 sires per litter,
suggesting a genetically polyandrous mating strategy in S. mokarran. Evidence
of geographic patterns of genetic structure in this species suggests that
genetic data may prove useful to source the broad geographic origin of S.
mokarran fins in trade and assist with delineation of stocks for individual
population assessment and general conservation efforts.
Nosal, Andrew (Scripps Institution of Oceanography); Lewallen,
Eric (University of Toronto Scarborough, Toronto, ON, Canada); Burton, Ronald
(Scripps Institution of Oceanography, La Jolla, CA, United States)
Low incidence of multiple paternity in leopard
sharks (Triakis semifasciata) sampled from a predominantly female aggregation
in southern California, USA
Knowledge of reproductive behavior is critical for
understanding population dynamics of elasmobranc fishes. However, the ultimate
and proximate causes of apparent mating systems are largely unresolved. Here, the percentage of litters sired
by multiple males (frequency of multiple paternity, FMP) was determined for a
sample of leopard sharks (Triakis semifasciata; n=19) captured from a
predominantly female (97.1%) aggregation in La Jolla, California, USA. Four
polymorphic microsatellite markers were isolated and developed from an enriched
library constructed exclusively for T. semifasciata. These loci were amplified
in a population sample of 138 presumably unrelated individuals (including 19
mothers) and found to exhibit moderate to high allelic diversity (9, 14, 16,
and 18 alleles per locus, respectively) without deviating from Hardy-Weinberg
expectations. The probability of detecting multiple paternity (PrDM) exceeded
0.99 for litters of 10 or more pups under varying degrees of paternal
reproductive skew. Tha is, the probability of a multiply sired litter not
having at least three unique paternal alleles at any locus (therefore being
incorrectly identified as singly sired) was <0.01, thus demonstrating the
power of the developed suite of microsatellite markers. A total of 380 pups
were genotyped from 19 litters (mean litter size SD [range] = 21.6 6.1 [11
– 33] pups). Only three of the 19 litters exhibited multiple paternity
(FMP = 15.8%), each with no more than two sires having equal reproductive
success. These results demonstrate that multiple paternity, and thus some degree
of sperm storage is possible in this species. However, the observed FMP is among the lowest reported for
any elasmobranch fish. The low FMP for T. semifasciata is not necessarily
selectively advantageous or disadvantageous, but may rather be the inevitable
consequence of sex-biased reproductive behaviors: females avoid harassment
(superfluous mating attempts) by retreating to aggregation sites where males
are largely absent.
Henning 202 Saturday, 9 AM; Chair George Burgess;
Elasmobranch Behaviour 2.
Lowe, Christopher (California State University Long
Beach); Alexander, Xydes; Forney, Christina; Manii, Esfandiar; Moline, Mark;
Clark, Christopher (California Polytechnic State University, San Luis Obispo,
San Luis Obispo, CA, United States)
The future of elasmobranch behavior research:
The development and utility of smart shark tracking robots
The evolution of acoustic telemetry tracking technology
has significantly advanced our knowledge and understanding of elasmobranch
behavior. Yet despite these advancements there are still logistical and
economic limitations to characterizing behavior of shark and rays in the wild.
To reduce some of these constraints we have developed an automated acoustic
telemetry tracking system for characterizing the diel fine-scale movement
patterns and habitat use of highly mobile coastal elasmobranchs. This system
utilizes a team of customized Iver2 Ocean Server autonomous underwater vehicles
(AUV) equipped with paired hydrophones and receivers. AUVs are able to track a
tagged shark and determine its position using particle filter estimation, while
simultaneously characterizing the seafloor and water column surrounding the
shark. Experiments demonstrate that localization of stationary and mobile
transmitters in coastal environments and autonomous tracking of tagged leopard
sharks using AUVs have position estimation errors better than those obtained
via manned active tracking. Specialized AUV controller programming is designed
to reduce behavioral interference, while identifying and characterizing
changing patterns of movement.
Hutchinson, Melanie (University of Hawaii); Anderson,
James (University of Hawaii); O'Sullivan, John (Monterey Bay Aquarium);
Holland, Kim (Hawaii Institute of Marine Biology)
A multiple instrument approach to elucidate the
movement and dive behavior of scalloped hammerhead sharks (Sphyrna lewini) in
Hawaii
Hammerhead sharks, Sphyrna lewini, use coastal embayments
such as Kaneohe Bay, Hawaii, as nursery grounds. Although considerable insights
have been gained into the behavioral ecology of the pups in these nursery
areas, little is known about the behavior of the adults after they leave the
bay or the extent of the catchment area from which
these adults come. To elucidate the behavior and dispersal of these seasonal
visitors to Kaneohe Bay we fitted seven adult male hammerhead sharks with
electronic tags; four with archiving pop-up (PAT) tags, four with position only
(SPOT) satellite transmitters and one double tagged with both a PAT and a SPOT.
All seven fish were also implanted with acoustic transmitters. Results from the PATs show offshore
vertical ranges exceeding depths of at least 1250 m, which are previously
un-documented for this species. Vertical profiles showed very clear diel dive
activity. Tagged hammerheads also exhibited previously unrecorded thermal
tolerances to at least 3C, spending an average 34.7% of their time in
temperature ranges from 3 - 6 C. Horizontal movement data suggest that these
adults stay close to the Hawaiian Islands – an interpretation supported
by the acoustic tag data which revealed repeated visits to Kaneohe Bay over an
extended period of time. However, these data are not yet extensive and are
limited to males. Nevertheless, these early results reveal an unexpectedly
large vertical range for this species in the offshore waters of Hawaii and
indicate that hammerheads have a wide ecological niche that probably includes
deep water prey.
Mucientes, Gonzalo (IIM-CSIC); Queiroz, Nuno (CIBIO,
Vairo, Portugal); Humphries, Nicholas (MBA, Plymouth, United Kingdom);
Saborido, Fran (IIM-CSIC, Vigo, Spain); Sims, David (MBA, Plymouth)
Movements, behaviour and habitat preferences of
pop-up satellite tracked shortfin mako sharks (Isurus oxyrinchus) in the North
Atlantic
The shortfin mako shark (Isurus oxyrinchus) is a highly
migratory, pelagic species with circum-global distribution in tropical and
temperate seas. This shark is commonly found in the Atlantic Ocean and are
taken as bycatch in longlining and gillnetting operations for tuna and
swordfish (Xiphias gladius), activities that have expanded rapidly during the
last 20 years. High demand for fins and its good-quality meat mean makos are
now highly prized by fishers. But despite the high prevalence, economic
importance, and vulnerability of this species, little is known about its
population dynamics and habitat-use. There is some evidence from conventional
tagging and fishery studies that complex population structuring and movements
may be contributing to recorded declines in the western Atlantic Ocean.
Shortfin mako sharks may remain faithful to particular regions, which together
with males and females apparently segregating into different regions for at
least part of the year may result in differential exploitation of vulnerable
components of the population (e.g. mature females, juveniles) exacerbating
declines. The aim of this study is to elucidate for the first time the
movements and behaviour of shortfin mako sharks from satellite-linked
electronic tagging and relate this to remotely sensed environmental fields to
identify fine-scale habitat preferences in the Atlantic Ocean. Pop-up archival
transmitting (PAT) tags were deployed recording vertical and horizontal
movements and temperature preferences of mako sharks tagged in oceanic waters.
Satellite tags were programmed to detach 30, 60, 90, 120 or 180 days after
deployment. A total of 16 makos (8 males, 8 females) were caught and tagged in
North Atlantic waters, specifically, in northwest, southwest and east of the
Azores islands from 2009 – 2011. Tagged sharks ranged from 120 –
255 cm (fork length). Mako sharks displayed different movement and residency
patterns, including a trans-Atlantic migration into western Iberia waters.
Satellite tracked sharks also displayed deep diving behaviour into cold water,
with maximum recorded depths of 1064 m (5.8 oC) with temperature preferences
ranging from 5.8 and 27oC.
Vila Pouca, Catarina (CIBIO - University of Porto);
Queiroz, Nuno (CIBIO - University of Porto, Vairo, Portugal); Mucientes,
Gonzalo (Instituto de Investigaciones Marinas, CSIC, Vigo, Spain); Humphries,
Nick; Sims, David (Marine Biological Association of the United Kingdom,
Plymouth, United Kingdom)
High-resolution diving behaviour revealed by
satellite tagging of blue sharks
Recent advances in satellite tagging technologies have
provided increased resolution in studying the movements, patterns of activity
and behaviour of individual animals in relation to different environmental
features. Such accurate records of long term vertical movements of large
predators at fine temporal resolutions have enabled the identification of
variable behavioural patterns amongst species, such as diel temporal shifts in
behaviour. In addition, by investigating diving behaviour in relation to
changing oceanographic variables and to potential foraging success, we are
beginning to understand why such behaviours occur at particular times and
places. The characteristics of dive profiles, including dive shape, have often
been useful to address such questions. For most species, dives can be
classified into predefined dive types based on their two dimensional shape, and
these types, or the dive characteristics within a type, may reflect activities
such as foraging, travelling or resting. Concerning marine fish, two main dive
types, V- and U-shaped, have been largely identified. Overall it is thought
that V-shaped dives are associated with transiting/prey searching behaviour,
while U-shaped profiles are related to foraging on aggregated prey. The identification
of different habitat uses, namely transiting and foraging areas, by analysing
the spatial distribution of the dive profiles is of great importance to the
recognition of key marine habitats. Thus, the ability to identify such critical
habitats, by combining data from many different species including large pelagic
predators, may be a valuable tool when identifying potential marine protected
areas. Here we analysed high resolution data (10s) on depth and temperature
experienced by satellite tagged blue sharks Prionace glauca in the eastern
Atlantic Ocean and obtained a detailed description of their vertical movements.
A total of 2890 dives by 4 blue sharks were recorded. Five dive types,
previously described for other species, were found to be commonly performed by
blue sharks. Type 1 (U- shaped) and 2 (V-shaped) dives were the most frequently
performed by blue sharks (ca. 48% and 32% of the total number of dives,
respectively) with all other dive types each representing <6% of the
total. Dives that did not conform to the generic classification scheme
represented 9.8% of total dives. Further analyses examined spatial and temporal
patterns of diving profiles in the eastern Atlantic Ocean
Pratt, Harold (Mote Marine Laboratory); Heist, Edward (Southern
Illinois University, Carbondale, IL, United States); Pratt, Theo (Mote Marine
Laboratory, Summerland Key, FL, United States); Carrier, Jeffrey (Albion
College, Albion, MI, United States)
Sexual conflict in the nurse shark,
Ginglymostoma cirratum: five compensatory behaviors
Different animal sexes often have differing reproductive
goals and unequal investments which result in a continuing conflict of
interests. In the annual nurse shark mating season at the Dry Tortugas,
Florida, sexual conflict is both striking and conspicuous. Males attempt to
force copulation by orally grasping or attempting to grasp the chosen females
pectoral fin. Females vigorously thwart 94.1% of male mating attempts (n=1280) by Refuging, by Avoiding and by cooperative Pectoral
Shielding. In group mating events (6.2 % of total events observed), males
counter these female maneuvers with two cooperative behaviors of their own; the
Simultaneous Caudal Grab and Blocking. As many as seven males have been observed to pursue a selected female, circle into position and compete
to grasp the females pectoral fins to coerce her to mate. In most
large group matings observed, one attendant, non-competitive male facilitates
male mating from the very first encounter by positioning himself in front of
the mating sharks limiting their forward motion.
Videography reveals that this males helping role (Blocking) is determined even
before the pectoral grasp is attained, or before the identity of the copulating
male in the event is decided by contest. Thus males may choose a helping role
on the mating grounds. The Simultaneous
Caudal Grab permits two males to work together to move an Avoiding female into
deeper water. Group courtship results in a copulation at least 40 % of the time
(n = 86). Male and female cooperation may have evolved as a reciprocal altruism
and not kin selection as microsatellite genotype analysis reveals low levels of
relatedness. Refuging and Pectoral Shielding are mutualisms probably derived
from schooling.
Calich, Hannah (Dalhousie University); Campana, Steven (Bedford
Institute of Oceanography, Dartmouth, NS, Canada)
Mating scars reveal mate size in blue sharks
(Prionace glauca)
Blue sharks (Prionace glauca) are the most abundant large
shark species in the Atlantic Ocean yet little is known about their
reproductive habits. Male blue sharks engage in precopulatory biting, which
produces mating scars on females. These scars are often observed on sexually
immature females. The objective of this study was to determine the size and
maturity status of male sharks attempting to mate with immature females. Using
data collected from sharks caught at annual Nova Scotia shark fishing
tournaments between 1993 and 2011, I found a significant curvilinear
relationship between male shark fork length and jaw gape. By using the mating
scar diameter as the independent variable, I was able to estimate the fork
length and infer the sexual maturity of the male sharks that produced the
mating scars. Results indicate that mature males with a mean fork length of 218
cm 24 cm were attempting to mate with sexually immature females However,
there was no significant relationship between the estimated size of the male
and that of the female with which it was trying to mate, indicating that male
blue sharks do not have a size preference for mating. Based on the female fork
lengths I suggest that the females should be classified as subadult instead of
immature, making it possible that these females were capable of sperm storage
and possibly self-fertilization.
Kajiura, Stephen (Florida Atlantic University);
Tellman, Shari (Florida Atlantic University)
Quantification of massive seasonal shark
aggregations
South Florida witnesses an enormous migration of marine
apex predators each year as massive aggregations of blacktip ( Carcharhinus
limbatus ) and spinner sharks ( C. brevipinna ) move through the area. The
close proximity of the Gulf Stream to the Palm Beach County (PBC) shoreline may
constrain the sharks to the coastal environment with tens of thousands of
individuals congregated in the shallow, nearshore waters. This natural
bottleneck in PBC provides a unique opportunity to estimate abundanc of the
southeastern US population of these important apex predators during their
annual migration. Over a sixteen month period, a biweekly aerial survey was
flown along the 75km length of PBC from Boca Raton inlet to Jupiter inlet with
a high definition video camera and digital SLR camera mounted out of the window
of the plane to provide a continuous record of the area from the shore seaward
to about 200m. The light-colored,
sandy seafloor and clear water characteristic of PBC facilitate visualization
of the sharks close to shore. The number of sharks was counted and used to
generate a seasonal population estimate but since the survey sampled only
sharks close to shore at depths less than 5m, the total population size is
actually much greater. Shark
abundance peaked in the winter (February) and declined to nearly zero in the
summer months and was inversely correlated with water temperature. The sharks
were not uniformly distributed along the coast, but appeared in loose clusters
of up to thousands of individuals. Although sharks could be found along the
entire length of PBC, the stretch of coastline between Boynton Inlet and Palm
Beach Inlet consistently exhibited the greatest numbers of sharks. There was no apparent correlation
between shark abundance and proximity to inlets or reef structure. In addition
to sharks, seasonal abundance of other large marine vertebrates, including
mantas and manatees, was also quantified, although neither demonstrated the
massive aggregations seen in the sharks. These baseline abundance data can be
used as a comparison for future studies to determine if shark population size
is changing and if sharks are restricting their southward migration as global
water temperatures increase. Future studies will employ electronic tagging of
sharks to determine the extent of their movements along the eastern seaboard.
Vaudo, Jeremy (Guy Harvey Research Institute; Florida
International University); Wetherbee, Bradley (Guy Harvey Research Institute;
University of Rhode Island, Canada); Howey, Paul (Microwave Telemetry, Inc.,
Columbia, MD, United States); Shivji, Mahmood (Guy Harvey Research Institute; Nova
Southeastern University)
Vertical movements of tiger sharks (Galeocerdo
cuvier) tagged in the US Virgin Islands
Tiger sharks (Galeocerdo cuvier) are a wide ranging
species that display a variety of horizontal movement patterns, making use of
coastal and pelagic waters. Far less, however, is known about their vertical
movements. To investigate the vertical movement behavior of tiger sharks around
the US Virgin Islands, seven individuals (4 males, 3 females) were tagged in
2008 with high rate, pop-up satellite archival tags (HR X-Tag, Microwave
Telemetry, sampling rate: every 3.5 to 4 min; 30-day programmed duration). Five
of the seven tags reported and uploaded 19 to 83% of archived data, providing
fine-scale depth and temperature data from a total of 105 days. Two sharks
displayed post-release dive irregularities lasting ~2 days. Sharks spent the
majority of their time making yo-yo dives (repeated oscillatory dives) within
the upper 50 m with 18 to 44% of their time spent within the upper 5 m. As a result,
sharks typically occupied a narrow temperature range (27 to 29C for four
sharks tagged in June and 25 to 27C for one shark tagged in March). Dives to
greater than 200 m were common and all sharks made dives to at least 400 m,
with one shark briefly exceeding 700 m and experiencing temperatures less than
9C. Although diel patterns were identified in four of the five sharks, whether
deeper dives were made during the day or night varied among individuals.
Overall, tiger sharks in the vicinity of the US Virgin Islands displayed a high
degree of variability in their dive patterns, but typically could be found in
the upper 50 m and making regular dives to the deeper waters available to them.
Wetherbee, Bradley (University of Rhode Island/Guy
Harvey Research Institute); Harvey, Guy (Guy Harvey Research Institute);
Burnie, Neil (Bermuda Shark Project, Hamilton, United Kingdom); Aming, Choy
(Bermuda Shark Project,); Byrne, Mike (University of Georgia); Shivji, Mahmood
(Guy Harvey Research Institute)
Contrary to ordinary - long-term movements of
tiger sharks reveal both variable and consistent movements
Tracking of 58 tiger sharks (Galeocerdo cuvier) in the
Western Atlantic, Caribbean and Australia using satellite transmitters has
revealed that their movements are highly variable among locations and
individual sharks. Sharks tracked in Bermuda demonstrate the most consistent
behaviors characterized by seasonal north-south migrations although movements
among sharks vary. Bermuda tagged sharks show an impressive ability to utilize
two very different marine ecosystems for nearly equal periods of time, spending
warmer months in the open ocean covering long distances, in contrast to winter
months primarily concentrated in coastal waters of The Bahamas. Individual sharks
tracked for extensive periods of time (< 1 yr) exhibited remarkable
consistency of movement between years, following similar migratory pathways and
occupying similar seasonal areas. Areas searched intensively by sharks in
oceanic waters were an order of magnitude larger than areas searched
intensively in insular waters. Long-term tracking of tiger sharks has
illustrated a combination of both behavioral plasticity and consistency
resulting in connectivity of disparate and distant marine ecosystems on
multiple scales.
Plank, Susanne (ElasmoTech Labs); Winston, Steven (ElasmoTech
Labs)
Photo identification using modern feature
recognition and classifiication
Photo identification has been used as a tool for
biological research for several decades as a non-invasive method for
recognizing study animals, and has been utilized across a wide range of taxa
from marine mammals to invertebrates. Though the matching process began as a
manual search through a catalog of collected photographs, it has now mostly been
supplanted by computer-assisted criteria matching or pattern recognition
programs. Despite these advances, programs still require manual
identification/confirmation of the programs' highest ranked candidate matches.
We have created a new image analysis program using updated computer science
algorithms to not only strongly match photos containing the same individual,
but identify groups that share similar physical characteristic. Here we present
data on initial tests with an inanimate object (coins). We haphazardly selected
100 United States pennies used as a knowledge base in 4 experiments. In Experiment 1
illumination and angle of the photo remained controlled, in Experiment 2
illumination was varied, in Experiment 3 angle was varied, and in Experiment 4
illumination and angle were varied in randomly selected combinations. Each of
these knowledge bases was subsequently tested with 4 conditions: control,
varied illumination, varied angle, and varied illumination/angle. Each of these
subsets consisted of 10 randomly selected US pennies from the knowledge base
(rephotographed under experimental conditions), 10 haphazardly selected novel
US pennies, one novel Canadian penny, and one novel US dime. Each of the 4
experiments (4 knowledge bases with 4 subsequent tests) was computed for 64
million iterations (16 million iterations per sub-test). US dimes and Canadian
pennies resulted in outgroup placement from the US pennies without error. A
total of 4 images had false positives during the analysis iterations, but for
no more than 2 of the 16 million iterations per test, giving very strong
support for the end result. All test pennies were correctly matched with their
knowledge base counterparts without error despite most test photographs having
a different illumination and/or angle from the original knowledge base
photograph. The preliminary results of this analysis are highly encouraging not
only for the individual identification of highly patterned species but for
those species lacking easily distinguished patterns. We soon hope to test this
program on coastal California elasmobranchs.
Henning 201 Saturday, 2 MM; Chair Dave Ebert;
Elasmobranch Genetics 2.
White, William (CSIRO Marine & Atmospheric Research); Last,
Peter (CSIRO Marine & Atmospheric Research, Hobart, T, Australia)
A review of taxonomy of chondrichthyan fishes: a
modern perspective
Taxonomic
clarity is a fundamental requirement as it forms the foundation of all other
life sciences. In the last decade, chondrichthyan taxonomy has undergone a scientific
renaissance with more than 180 new species formally described. This effort
encompasses about 15% of the global chondrichthyan fauna which consists of 1185
currently recognised chondrichthyan species. The important role of
chondrichthyan taxonomy for conservation management has been highlighted in
recent years with new species descriptions or taxonomic resolution of a number
of threatened species. These include Australian gulper sharks (genus
Centrophorus) and speartooth sharks (genus Glyphis) in coastal waters of
Australia and Borneo. Closer examination of other wide-ranging species for
which the taxonomy was thought to be stable, have shown that they consist of
species complexes, e.g. manta rays (Manta) and spotted eagle rays (Aetobatus
narinari complex), and highlights the need for critical re-examination of other
wide- ranging species. Molecular
methods have provided another useful tool to taxonomists and they have proven
to assist greatly with identifying cryptic species and species complexes. However,
the limitations of particular molecular methods being used need to be carefully
considered and there are some concerns about how these are being integrating
with classical taxonomy. The fundamental importance of taxonomic nomenclature
to life sciences is often poorly understood but striving for nomenclatural
stability is a critical component of taxonomy. Similarly, biological
collections are an extremely vital asset to both taxonomist and the broader
scientific community. These collections have becoming increasingly important
due in part to molecular species identification initiatives such as the Barcode
of Life which has resulted in a large number of voucher specimens linked to
tissue samples being deposited. Biological collections are also proving to be
imperative in biodiversity studies as they contain a gold mine of historical
collectio information important for assessing changes in faunal assemblages.
Resources are typically limited for taxonomic research and the
ageing taxonomic community is another issue of concern for the future of
taxonomy on this important group. Succession planning and better resource
allocation will be essential to ensure that this fundamental discipline is
maintained into the future.
Hinojosa, Silvia (UNAM);
Genetic Differences between Giant Manta ray
(Manta birostris) and the Yucatan Giant Manta ray.
Based on coloration and morfological differences, the
existence of a possible third species for the genus Manta has been suggested in
previous studies. At least two morphotypes with variations in mouth, ventral
and dorsal colorations as well as in some key morphological features has been
observed in the giant manta of the Mexican Carribean. In order to test the
hypothesis about whether those differences are produced by environment or have
a genetic basis we used several mitochondrial DNA markers both nuclear (RAG1)
and mitocondrial (ND5, COI, 12S and 16S), to determine if there are enough
differentiation levels to further contribute to the definition of the possible
third manta ray species previously reported. In addition samples of M.
birostris and Manta sp .were sent to be analyzed by new generation sequencing
techniques to create a genomic library and to look for otrher possible
differences in the complete mitocondrial genome. This work reveals our primary
findings using ND5 and COI genes. The DNA from 30 samples collected at Holbox
Mexico and Revillagigedo Islands, were amplifyed, sequenced, aligned and
compared to determine if it exists enough genetic variation between the Mexican
populations and the previously reported species ( Manta birostris ). The
sequences for each mtDNA region, are being compared with those of Pacific in
order to estimate the mean genetic divergence and their correlation with
isolation processes.
Thomas, W. Kelley (UNH/Hubbard Center for Genome
Studies); King, Benjamin (Mount Desert Island Biological Laboratories, Canada);
Genome, Skate (Northeast Bioinformatics Collaborative, Canada)
The Skate Genome Project
The little skate (Leucoraja erinacea) is a member of the
most primitive surviving clade of jawed vertebrates, thecartilaginous fishes
that first appeared approximately 450 million years ago. Cartilaginous fishes
exhibit manyfundamental vertebrate characteristics, including a neural crest,
jaws and teeth, an adaptive immune system, and a pressurized circulatory
system. The skate is a powerful comparative model to study biological processes
shared among jawed and limbed vertebrates such as renal physiology, immunology,
toxicology and regeneration. The North East Bioinformatics Collaborative of the
North East Cyberinfrastructure Consoritum (NECC) is a team ofbioinformatics
experts from five member states and is currently sequencing the genome of the
skate to enable comparative genomic studies. We are characterizing the genome using the whole genome
shotgun sequencing approach and Illumina high-throughput sequencing. To date,
we have 59x coverage of the estimated 3.4 Gbp genome by generating over 200 Gbp
of sequence in 1.8 billion sequencing reads that are primarily from a
paired-end fragment library with a 500bp insert size. An initial de novo genome
assembly yielded three million contiguous (contig) sequences. Together the
contigs represent 40% o the estimated genome. One of these contigs represents
the entire 16.7kb mitochondrial genome. We are currently constructing mate-pair
sequencing libraries that will be used to build scaffolds. So far, a 3.5 kbp
mate-pair library was generated and sequenced at low depth. Theskate genome
sequence project has served as an important model for highly
collaborativebiomedical research, especially with regards to improved
biomedical workforce development through cyber-enabled research. Three week-
long workshops provided bioinformatics training in genome andprotein sequence
analysis and annotation to faculty, students and other researchers among NECC
institutions.
Straube, Nicolas (College of Charleston);
Corrigan, Shannon (College of Charleston, Charleston, SC, United States); Li,
Chenhong (College of Charleston, Charleston, United States); Rochel, Elisabeth;
Rosana, Kerri; Naylor, Gavin (College of Charleston, Charleston, SC, United
States)
Putting some jaws on the Tree of Life:
Taxon-rich estimates of elasmobranch phylogeny based on mitochondrial and nuclear
DNA markers
Exploring patterns and processes of evolutionary change in
the elasmobranch fishes may be critical to understanding vertebrate
diversification and success. The elasmobranchs hold an important position in
the gnathostome tree because they are basal, sister to the Osteichthyes while
also showing similarities with the mammals in terms of genome organization. In
spite of this importance, and widespread fascination with sharks among the
scientific and general communities, we know relatively little about the
interrelationships among constituent members of the group. To date, most
molecular based estimates of elasmobranch phylogeny have been based on
mitochondrial DNA sequence data. While such estimates are useful, they
constitute a single gene tree, which may or may not accurately depict true
species level relationships. To be reliable, estimates of phylogeny must be
based on multiple independent markers. In the few cases where independent
nuclear gene markers have been used to estimate the relationships among
elasmobranchs, taxon-sampling has been sparse and the resulting trees have been
highly discordant. We present, for the first time, a phylogeny based on 8
protein coding loci (7 nuclear, 1 mitochondrial) among 150 of the 190 described
genera of elasmobranchs, representing 56 of 57 extant families. We identify the
phylogenetic signal that is common to all 8 markers and discuss the differences
in signal among genes.
Henning 202 Saturday, 2 MM; Chair James Sulikowsky;
Elasmobranch Behaviour 3.
O'Shea, Owen (Australian Institute of Marine science);
Bioturbation by stingrays at Ningaloo Reef,
Stingrays are an important part of the biomass of the
fishes in shallow coastal ecosystems, particularly in interreefal areas. In
these habitats, they are considered keystone species – modifying physical
and biological habitats through their foraging and predation. Here, we quantify
the effects of bioturbatio by rays on sand flats of Ningaloo Reef lagoon in
Western Australia. We measured the daily length, breadth and depth of 108
feeding pits over three 7-day periods, created by stingrays (Pastinachus atrus,
Himantura spp. Taeniura lymma and Urogymnus asperrimus) in Mangrove Bay.
Additionally, an area of, 1 km2 of the lagoon at Coral Bay was mapped three
times over 18 months, to record patterns of ray and pit presence. Over 21 days
at Mangrove Bay, a total of 1.08m3 of sediment was excavated by rays, equating
to a sediment wet weight of 760.8 kg, and 2.42% of the total area sampled, or
0.03% of the whole intertidal zone. We estimate that up to 42% of the soft
sediments in our study area would be reworked by stingrays each year. Based on
a model predicting the probability of pit presence over time, there was a 40%
probability of ray pits persisting for 4 days before being filled in but only a
15% probability of a pit being present after 7 days. Changes in pit volume over
time were static, providing evidence for secondary use. Our results imply that
rays play an important ecological role creating sheltered habitats for other
taxa in addition to the turnover of sediments
Guttridge, Tristan (Bimini Biological Field Station
Foundation); Brown, Culum (Macquarie University, Sydney, Australia)
Learning and memory of Port Jackson sharks,
Heterodontus portusjacksoni
Basic understanding of the fundamental principles and
mechanisms involved in learning are extremely lacking for cartilaginous fishes.
Our aim in this study was to experimentally investigate the learning and memory
capacity of juvenile Port Jackson sharks, Heterondontus portusjacksoni. Sharks
(N = 30) were conditioned over a 19-day period to associate an underwater LED
light or stream of air bubbles (conditioned stimulus, CS) with a food reward
(unconditioned stimulus, US), in three procedures (delay, trace and control) . During experiments the CS
signaled at a random time between 180 and 300s for 30s. For delay (US
overlapped in time with CS), for trace (US delivered 10s after CS) and for
control (US delivered random time between 180 and 300s after CS). H.portusjacksoni
trained in all procedures improved consistently in their time to obtain food,
indicative of learning. Importantly the number of sharks in the feeding area 5s
prior to the CS signaling did not change over time for any procedures. However,
significantly more sharks were present 5s during CS signaling for delay (air
bubble) and trace (light). Sharks trained in the delay and trace procedures
(air bubble CS) also displayed significantly more anticipatory behaviors, such
as turning towards the CS and biting. Sharks trained with the light CS did not
exhibit any biting behaviors however trace procedural sharks did show a
significant improvement in turning towards the CS at its onset. At 40 and 20
days after the end of the conditioning experiments some sharks were presented
the CS without reward. Two sharks trained in the delay procedure (air bubble
CS) exhibited movement and biting behaviors. This study demonstrates that
H.portusjacksoni have the capacity to learn a classical conditioning procedure
relatively quickly (some in <5 days), associate tw time-separated events and
retention of learnt associations for up to 40 days.
Queiroz, Nuno (CIBIO - University of Porto); Humphries, Nicolas
(Marine Biological Association of the United Kingdom, Plymouth, United
Kingdom); Mucientes, Gonzalo (IMM CSIC, Vigo, Spain); Sousa, Lara (CIBIO -
University of Porto, Vairao, Portugal); Sims, David (2Marine Biological
Association of the United Kingdom, Plymouth, United Kingdom)
Behaviour, critical habitat and fisheries interactions
of pelagic sharks in the North Atlantic Ocean
Surface longlines are widely known to interact with
several marine predators and are linked with declines in targeted and bycatch
species in the open ocean, including seabirds, turtles, tunas and sharks. Many
large pelagic predators, such as blue Prionace glauca and mako sharks Isurus
oxyrinchus, are of current conservation concern because of their vulnerability
to overfishing and rapid declines in populations. Management of pelagic shark
populations is poorly developed and takes little account of behavioural
characteristics such as spatial and temporal movements and distributions.
Recent studies show that some species remain faithful to particular regions
with males and females segregating into different regions for at least part of
the year. This raises the issue of whether fisheries concentrate in key
critical areas where, for example, the majority of a population aggregate for
feeding or mating opportunities, or where important components of a population
choose to remain. Consequently, we need to know the extent to which fisheries
overlap with different components of blue and mako shark populations in space
(both vertically and horizontally) and time. Using vessel monitoring system
(VMS) data from Portuguese and Spanish surface longliners operating in the
North Atlantic and recorded movements of blue and mako sharks from
satellite-linked pop-up (PAT) tags, we aimed at identifying and characterising
critical habitats of these species, for testing the extent of space-use overlap
with pelagic fisheries, and thus, investigate the vulnerability of sharks to
bycatch mortality. Geolocations and behaviour of individual sharks were related
to high-resolution maps of environmental variables (e.g. sea surface temperature,
frontal boundaries, sea altimetry and productivity) to quantitatively
characterise the preferred habitat and, using GIS technology and geostatistics,
the degree of spatial and temporal overlap of shark distributions, including
migrations, with the spatial extent and density of satellite-tracked longlining
fishing vessels was quantified. Longlines were deployed over an extensive area
from 0 – 60oN and 2 – 62oW, with fishing effort generally
concentrated in three wide-ranging areas in the North Atlantic. Tracked sharks
also occupied a broad geographical area, but displayed high space-use of
specific regions over 90 to 180 days. Our results indicate that different
segments of the blue shark population may be facing differential risk from
spatially heterogeneous longlining effort, depending on which geographical
regions are occupied at specific times. Preliminary results on the space-use
overlap between oceanic-tagged sharks and the longlining fleet operating in
North Atlantic waters will be presented.
Wueringer, Barbara (University of Western
Australia); Squire, Lyle (Cairns Marine, Stratford, Q, Australia); Collin,
Shaun P. (University of Western Australia, Crawley, Q, Australia)
Intraspecific interactions between sawfish
In Australia, freshwater sawfish Pristis microdon inhabit
the upper reaches of rivers during their juvenile life. In these turbid
environments, they are known to move into shallow water, and anecdotal evidence
suggests that they may form groups or aggregations. However, the behavioural
mechanisms behind such aggregations have never been investigated. Bonnethead
sharks Sphyrna tiburo form hierarchies within a group, based on smaller
specimens giving way to larger ones when swimming on a course that would cause
a collision. Our behavioural analyses of juvenile freshwater sawfish in their
first months in captivity found that in 58 % of cases that may lead to a
potential collision, both approaching are sawfish equally likely to move out of
the way, while in only 26% of cases a smaller sawfish would give way to let a
larger animal pass. This indicates that sawfish may use other strategies to
establish hierarchies that avoid potential collisions with their toothed
rostra. One such strategy will be described in detail, based on findings that
sawfish touch each other on various parts of the body with their rostra.
Moreover, analyses of interactions in feeding sawfish clearly indicate the
dominance of larger individuals, which use behaviours of varying aggression to
steal food from smaller individuals. Larger sawfish succeeded in stealing food
from smaller conspecifics in 60% of their attempts, while smaller sawfish never
succeeded in stealing food from a larger animal. During such interactions,
sawfish may use their rostrum to pin the rostrum of another sawfish onto the
substrate, which results in the pinned animal moving backwards to escape and
the loss of its prey in the process. The present study indicates that removal
of the rostrum of a live sawfish (which seems to become more common in countries
where sawfish are protected but interact with recreational fishermen) may not
only affect its ability to sense and manipulate prey but also to successfully
interact with conspecifics. If adult sawfish interact with each other in ways
similar to juveniles, removing the rostrum may also effectively remove them
from the reproductive pool.
Henning 201 Sunday 09:00; Chair Charles F. Cotton;
Symposium 10:Deep-water Chondrichthyans 1.
Cotton, Charles (Virginia Institute of Marine
Science); Grubbs, Dean (Florida State University, Canada)
Biology of Deep-water Chondrichthyans:
Introduction
Approximately half of the known chondrichthyans, nearly
600 species, live in the deep ocean (below 200 m), yet little is known of the
biology or life history of most of these fishes. The limited information about
deep-water chondrichthyans is often confounded by uncertainty in the taxonomy
and systematics of these taxa and new species are frequently described.
Research is also hindered because many species are known from few specimens of
only the type material. The need for more research and dissemination of
information about deep-water chondrichthyans has become more urgent as
fisheries worldwide expand deeper. Until recently, much of the fishing effort
on deep-water chondrichthyans was localized and often artisanal. However,
contemporary fishing effort for deep-water sharks has been increasing
worldwide, in spite of considerable data indicating that deep-water fishes have
among the slowest of vertebrate life histories (slower growth, delayed
maturity, lower fecundity). K-selected life histories render these deep-water
species susceptible to overexploitation and localized depletion, yet most
exploitation occurs in the absence of the species-specific life history or biological
information needed to develop management plans. This symposium will provide a
forum for the dissemination of the extensive volume of new information
available on this unique group of fishes, including data that may inform
management plans and conservation efforts. It will also facilitate the
formation of networks of deep-water chondrichthyan researchers working within
the sub-disciplines of taxonomy, telemetry, feeding and trophic dynamics, age
and growth, biogeography, physiology, reproductive biology, and population
genetics.
Cotton, Charles (Virginia Institute of Marine
Science); Grubbs, Dean (Florida State University Coastal
and Marine Laboratory, St. Teresa, FL, United States);
Musick, John (Virginia Institute of Marine Science,
Gloucester Point, VA, United States)
Reproduction and embryonic development in two
species of North Atlantic squaliform sharks, Centrophorus cf. niaukang and
Etmopterus princeps: evidence of matrotrophy?
Chondrichthyans ovulate much larger eggs and undergo a
more protracted embryonic development than bony fishes. As a result, some
organic matter originally present in the chondrichthyan egg yolk is depleted
via metabolic excretion over the course of embryogenesis. Previous studies have
suggested that the energetic toll of embryogenesis in lecithotrophic species
depletes organic matter in the egg by more than 20% during embryonic
development. Conversely, organic matter in developing embryos of matrotrophic
species is augmented by various forms of maternal nourishment, resulting in
organic matter depletion of less than 20% during embryogenesis. We compared the
mass of organic material in freshly fertilized eggs to that of near-term
embryos to investigate the maternal-embryonic nutritional relationshi of
Centrophorus cf. niaukang and Etmopterus princeps collected from the North
Atlantic. Measurements of ash-free dry weights of a series of embryos revealed
that some form of maternal nutrient contribution, likely mucoid histotrophy,
occurs in at least one species. Centrophorus cf. niaukang embryos undergo a reduction of 19.5% in
organic matter, while E. princeps embryos undergo a reduction of 7.8% in
organic matter over the course of embryonic development. Uterine villi were
present in both species and became larger and increasingly vascularized over
the course of gestation. Though previous studies have suggested a strictly
respiratory and ionic exchange function in similar species, the aggregate role
of these uterine villi is not fully understood and they likely produce mucoid histotroph
in the species we examined.
Embryos of C. cf. niaukang were also dissected in order to track the
partitioning of water, organic matter, and inorganic matter to the liver,
external yolk sac, internal yolk sac, digestive tract, and eviscerated body,
throughout development. Observed fecundity and maturity ogives are also
presented along with comments on the apparent aseasonality of mating and the
ovarian cycle of each species. Likewise, we present the observed patterns of
segregation by sex and reproductive stage for each species. Our results are
compared with previous studies of reproductive biology and maternal embryonic
nutritional relationships of other chondrichthyans.
King, Jackie (Fisheries and Oceans Canada); McPhie, Romney
(Fisheries and Oceans Canada, Canada)
Age, growth and maturity estimates of spotted
ratfish (Hydrolagus colliei) in British Columbia
The spotted ratfish (Hydrolagus colliei) is a deepwater
chimaera ranging from southeast Alaska to Baja California and is found at
depths of up to 1,150 m. There is no commercial fishery for spotted ratfish in
British Columbia, but it is one of the dominant species routinely captured in
groundfish bottom trawl surveys. Despite being a large component of the
ecosystem, few biological parameter estimates exist for spotted ratfish due to
a lack of suitable ageing structures to estimate age and growth. We sampled
over 234 spotted ratfish captured in trawl surveys off the coast British
Columbia ranging in size from 12 cm to 61.7 cm. The size at maturity estimates
were larger for females (22.5 cm snout-vent length) than males (17.5 cm). Both
estimates are larger than those made for spotted ratfish off of California
indicating regional differences in life history traits for this species. We
present preliminary results of age estimates based on tritor counts on the
vomerine plate. Based on these age estimates, we present growth curve and
age-at-maturity estimates for spotted ratfish. The vomerine plates are
candidate ageing structures for spotted ratfish, and warrant further
investigation.
Pompert, Joost (Falkland Islands Fisheries Department); Pierce,
Graham (Aberdeen University, Canada); Brickle, Paul (Falkland Islands Fisheries
Department); Arkhipkin, Alexander (Falkland Islands Fisheries department)
A comparison of the life history strategies of
the Falkland skate (Bathyraja macloviana) and the joined-fin skate (Bathyraja
cousseauae) using age estimations from caudal thorns.
Life history parameters for the Falkland skate, Bathyraja
macloviana and the joined-fin skate Bathyraja cousseauae from specimens caught
in waters around the Falkland Islands are presented, with age and growth
estimates derived from 496 and 357 caudal thorn samples respectively. Bathyraja
macloviana were aged to 14 years, whereas B. cousseauae were aged to 20 years.
Growth between the two species was very different, with the von Bertalanffy
growth model (K= 0.21, L=60.6cm Lt) best describing B. macloviana, and the
Gompertz growth function best describing B. cousseauae (G=1.937, k=0.178,
L=124.5 cm Lt-). In both species the females are heavier at size than the
males, and females reach a slightly larger size. Age increments were validated
using two techniques: an oxytetracycline tag-recaptured B. cousseauae that had
been at liberty for 212 years, and edge analyses of a subsample of young
specimens. Sizes and ages at 50%
maturity derived from maturity stages are also presented. For female B.
macloviana this is 50.2cm Lt and 7.0yrs, for males 46.0cm Lt and 6.8yrs. For
female B. cousseauae these values are 96.7cm Lt and 10.3yrs, for males 91.4cm
Lt and 9.0yrs. Of the 16 skate species that occur in the Falkland fishery, 8
have to date been age-assessed, with the new life history information on these
2 species providing further insight into the inter-assemblage dynamics. With an
increasing amount of ageing studies completed stock management models can be
refined.
Rigby, Cassandra (Centre for Sustainable Tropical
Fisheries and Aquaculture & School of Earth and Environmental Sciences, James
Cook University); Simpfendorfer, Colin (Centre for Sustainable Tropical
Fisheries and Aquaculture & School of Earth and Environmental Sciences,
James Cook University, Townsville, Australia)
Habitat associations of deepwater chondrichthyan
life history traits
Life history traits are important indicators of the
productivity of a species, and its ability to tolerate fishing pressure. Using
a variety of life history traits (male and female traits of maximum size, size
at maturity, age at maturity, longevity, growth rate and size at birth) from a
wide range of chondrichthyans we demonstrate that there are life history
differences between shelf, oceanic and deepwater habitats. This included
deepwater species having lower growth rates, later age at maturity and higher
longevity than both shelf and oceanic species. This analytical review used a
larger suite of species than previously assessed and also undertook an
examination of deepwater species life history traits associated with depth and
geographic range. We examined the patterns in life history traits by depth
(upper, mid and deep slope), region (North and South Atlantic, North and South
Pacific) and latitudinal zone (Polar, Temperate and Tropical). North Atlantic
female deepwater chondrichthyans were found to have significantly higher growth
rates and lower longevity than those in the South Atlantic and size at birth
was smallest in species inhabiting the deeper slope habitats, Polar to
Temperate zones and the North Atlantic region. There was a trend for both male
and female chondrichthyans of lower growth rate, later age at maturity and
higher longevity with increasing depth. However this trend was not significant
when phylogenetic relatedness and size were taken into account which suggests
that differences in species composition and size among habitats can drive these
trends and stresses the importance of accountin for these to clearly determine
the influence of habitat on life history traits. These associations of life
history traits with habitat, both among deep, shelf and oceanic species and
within deepwater species will be discussed within the context of ecological
theories and conservation strategies.
Hoen, Danielle (University of Hawaii Manoa); Drazen, Jeffrey;
Popp, Brian; Condon, Nicole (University of Hawaii Manoa)
Does elasmobranch trophic position increase with
depth? Interpreting bulk isotope data with compound-specific isotope analysis
of amino acids
Increasing fishing pressure and the threat of climate
change make understanding the trophic biology of poorly studied deep water
chondrichthyans critical. Increasingly, bulk isotope analyses are utilized to
determine trophic relationships among these organisms. However, there is much
uncertainty when interpreting bulk isotope data in an ecological context. For
instance, changes in baseline isotopic composition and possible fractionation
differences among organisms complicate bulk isotope analyses. It was recently
found that chondrichthyan 15N enrichment increases with depth, suggesting an
apparent increase in trophic position (TP) with depth. It has been hypothesized
the production of urea by these species may be lowering nitrogen isotope
fractionation. If this is the case, decreasing urea content with depth would
drive a subsequent increase in nitrogen isotope fractionation, leading to the
apparent increase in TP indicated by bulk isotope data. We analyzed the livers
of two species of skate, Raja rhina and Amblyraja badia (median depth of
occurrence: 539 m and 1585 m respectively), caught from a depth gradient
ranging over 1500 m using compound specific isotope analysis of amino acids in
addition to glutamate dehydrogenase and glutamine synthetase enzyme assays to
determine if this trend was a product of baseline δ15N changes, a change
in nitrogen isotope fractionation, or an actual increase in TP. Phenylalanine
δ15N values varied little over this depth range, indicating no change in
baseline δ15N values. Rather the apparent trend
may be driven by changes in fractionation due to urea retention. These results
serve to caution researchers and fisheries managers when making assumptions
about ecosystem dynamics in the deep sea based on bulk isotope data.
Musick, John (Va Inst Mar Sci); Cotton, Charles (Va Inst Mar
Sci, Gloucester Pt, United States)
Bathymetric limits of chondrichthyans in the
deep sea
Chondrichthyans are largely absent in abyssal (>300m)
habitats in most regions of the world ocean are uncommon below 2000m. The
deeper-living chondrichthyans include certain rajids, squaliforms and holocephalans.
Several hypotheses have been erected to explain the absence of chondrichthyans
from the abyss. These are mostly based on energetics: Deep-sea food webs are
impoverished due to their distance from primary production, and
chondrichthyans, occupying the highest trophic levels, cannot be supported due
to entropy among trophic levels. We examine this hypothesis by comparing
trophic levels, calculated from dietary data, of deep-sea chondrichthyans with
those of deep-sea teleosts. Chondrichthyans were mostly above trophic level 4,
whereas all the teleosts examined were below that level. The potential prey
field for both chondrichthyans and teleosts declines in biomass and diversity
with depth, but teleosts appear to have more flexibility in their feeding mechanisms
and food habits.
Brooks, Edward (Cape Eleuthera Institute); Brooks, Annabelle;
Williams, Sean (Cape Eleuthera Institute, Rock Sound, Bahamas); Chapman, Demian
(Stony Brook University, Stony Brook, United States); Howey, Lucy; Jordan,
Lance (Microwave Telemetry, Columbia, United States); Abercrombie, Debra
(Abercrombie and Fish Consulting, Port Jefferson Station, United States);
Grubbs, Dean (Florida State University, St. Teresa)
The diversity, distribution and demographic
population structure of deep water elasmobranchs in the northeast Exuma Sound,
the Bahamas
There is a fundamental lack of basic taxonomic, biological
and ecological information pertaining to the majority of deep water species, in
particular elasmobranchs, largely due to the logistical challenges of sustained
ecological investigation in this remote and hostile ecosystem. The Exuma Sound
is a deep water inlet of the Atlantic Ocean ranging in depth from 500 –
2000 m and characterized by steep walls along its margin. The sound is in close
proximity to land (<3 km), facilitating the sustained investigation o its
deep water elasmobranch fauna over extended periods of time. A total of 69 deep
water longline surveys were conducted from September to December in both 2010
and 2011 (depth: 472.6 – 1024.1 m; seabed temperature: 15.6 – 5.9
C), resulting in the capture of 144 sharks of at least eight different
species. This does not include a potentially new species of Centrophorus
currently undergoing morphological and genetic assessment. Elasmobranch species
richness declined significantly with
increasing distances
from the edge of the Exuma Sound (ρ = -0.295, p = 0.014), increasing depth
(ρ = - 0.242, p = 0.045), and increasing
seabed water temperatures (ρ = 0.288, p = 0.016). Distance from the edge
of the Exuma Sound was a significant predictor for the presence or absence of
Squalus cubensis, Mustelus canis insularis, Centrophorus spp., Hexanchus
nakamurai and Centroscymnus owstoni.
Furthermore, depth and temperature were significant predictors of the
presence or absence of S. cubensis, M. canis insularis and C. owstoni. Depth
was also a significant predictor of presence or absence of H. nakamurai. There
were no predictable trends in the abundance of Hexanchus griseus, Galeus
springeri or Pseudotriakis microdon. Significantly skewed sex and/or maturity
ratios were identified for a number of species suggesting that this is a common
life history trait in deep water elasmobranchs. The results of this study
indicate that the use of deep water longline surveys in the Exuma Sound, and
similar oceanographic areas, is an efficient and cost effective method for the
sustained investigation of deep water elasmobranchs, and is vital for the
effective management of this especially vulnerable group of species.
Gelsleichter, Jim (University of North Florida);
Grubbs, Dean (Florida State University Coastal and Marine Laboratory);
Heithaus, Michael (Florida International University, ); Leary, Arianne; Piercy,
Andrew (University of North Florida)
Effects of the Deepwater Horizon Oil Spill on
deepwater shark populations from the northeast Gulf of Mexico.
As the largest oil spill in history in U.S.-controlled
waters, the Deepwater Horizon Oil Spill resulted in extensive contamination of
Gulf of Mexico waters. This poses significant health risks to numerous marin
wildlife populations, especially deepwater species residing in offshore waters
within and/or adjacent to the primary contamination zone. Given the
population-level impacts that have occurred in some wildlife species as a
result of chronic exposure to oil constituents from prior oil spills (e.g.,
Exxon Valdez oil spill), it is critical to monitor the
health of the Gulfs deepwater fauna to assess the full impacts of the
Deepwater Horizon Oil Spill on these animals. Therefore, to address this problem, the goal of this study
was to determine if deepwater fish assemblages in the northeast Gulf of Mexico
are being exposed to and are experiencing effects of exposure to polycyclic
aromatic hydrocarbons (PAHs), the most toxic constituents of oil. To accomplish
this, we examined 4 biomarkers of PAH exposure and effects in multiple
deepwater elasmobranch species collected from areas impacted by the Deepwater
Horizon Oil Spill: 1) activity of the PAH-metabolizing Phase I
biotransformation enzyme, cytochrome P450 1a1 (Cyp1a1); 2) biliary
concentrations of PAH metabolites; 3) the occurrence of covalent associations
between PAH metabolites and DNA; and 4) chromosomal abnormalities. PAH
biomarkers were compared with those measured in deepwater sharks collected from
unimpacted reference locations on the west Florida shelf. Cyp1a1 activity was
significantly greater in sharks from oil-impacted locations compared with those
from reference sites, suggesting that deepwater sharks are exhibiting
physiological effects of oil exposure. However, evidence for cell- and
organ-level effects was minimal, perhaps indicating that heighted oil exposure
and metabolism is still below the threshold necessary to elicit higher level
responses.
Henning 202, Sunday 09:00; ChairMichael Heithaus;
Elasmobranch Ecology 2.
Burkholder, Derek (North Miami); Heithaus, Michael;
Fourqurean, James (Florida International University, North Miami, FL, United
States); Wirsing, Aaron (University of Washington, Seattle, WA, United States)
Top-down control in a relatively intact seagrass
ecosystem
Coastal marine ecosystems have been degraded dramatically
worldwide and continue to be threatened. Seagrass ecosystems, which provide
critical habitat for juveniles of many species, including commercially
important ones, have been particularly hard-hit. Of particular interest is the
loss of large herbivores (e.g. sea turtles and sirenians) and top predators
(e.g. sharks), which may have disrupted top-down processes that were
historically important. We used exclusion cages to elucidate the effects of
large herbivores (green sea turtles, Chelonia mydas and dugongs, Dugong dugon)
on seagrass community structure, nutrient dynamics, and ecosystem dynamics in
the relatively pristine seagrass ecosystem of Shark Bay, Western Australia. We
also investigated the possible indirect effect of top predators (tiger sharks,
Galeocerdo cuvier) on seagrass beds mediated by spatiotemporal shifts in
grazing by green turtles and dugongs. Excluding large grazers from mixed beds
of Halodule uninervis, Cymodocea angustata, and Halophila ovalis for thirty-two
months resulted in a shift in seagrass community composition, increased shoot
lengths in all species and increased total seagrass biomass. However, seagrass
responses to exclusion were species-specific. There were increases in percent
cover and shoot density for Cymodocea angustata but a decrease in cover and
density for both Halodule uninervis and Halophila ovalis. Overall, our findings
suggest that spatiotemporal shifts in foraging habitat use by megagrazers may
mediate indirect effects of tiger sharks on the seagrass communities of Shark
Bay and that decline in these taxa in other parts of their range are likely to
result in changes to seagrass communities.
Heithaus, Michael (Florida International
University); Cindy, Bessey (Florida International University, North Miami,
United States); Burkholder, Derek (North Miami, North Miami, United States);
Fourqurean, James (Florida International University, North Miami, United
States)
Do tiger sharks influence seagrass ecosystems
through multiple indirect pathways?
The importance of large-bodied herbivores in structuring
seagrass ecosystems in undisturbed seagrass communities has begun to receive
considerable attention. Less appreciated is the possibility that the
structuring role of these herbivores was driven by top-down impacts of large
predators (e.g. sharks) that also have undergone dramatic declines in many
regions. The potential for large predators to modify the spatiotemporal pattern
and intensity of herbivory is further complicated by their broad diets and the
possibility that they might indirectly influence seagrass communities through
multiple pathways that could serve to amplify or attenuate the strength of
top-down effects. We used the relatively pristine seagrass ecosystem of Shark
Bay, Western Australia as a model system for investigating top-down effects of
grazers and top predators in the absence of major anthropogenic impacts. Using
a combination of nested exclosures and seagrass transplant experiments, as well
as surveys of habitat use and abundance of tiger sharks (top predators),
megagrazers (turtles, sea cows), piscivores, and mesograzers (teleosts) we
investigated potential shark-induced trophic cascades through multiple
pathways. Both pathways appear to have the potential to mediate indirect
effects of tiger sharks on seagrasses and likely work in concert to amplify
top-down impacts. Combined with other studies showing the potential of grazers
at high population densities to heavily impact seagrass beds, our results
suggest that the loss of top predators could have important consequences for
the structure and stability of seagrass ecosystems.
Drymon, Marcus (Dauphin Island Sea Lab); Powers, Sean; Kroetz,
Andrea (Dauphin Island Sea Lab); Kevin, Feldheim (Field Museum); Gautreaux,
Jill; Moore, Frank (University of Southern Mississippi)
Are tiger sharks a seasonal conduit of
terrestrial energy into marine foodwebs?
As apex predators, some shark species have the potential
to couple energy pathways from disparate foodwebs. This is particularly true of
tiger sharks, highly migratory fish known for the breadth of items they
consume. In addition to foraging on invertebrates, bony and cartilaginous
fishes, sea snakes, marine mammals and seabirds, tiger sharks are known to
consume terrestrial birds. While accounts of this predator-prey interaction
date back over half a century, we know little about the pervasiveness of this
phenomenon within a population, or of the potential contribution terrestrial
birds make to the diet of tiger sharks. We investigated the extent to which
individual tiger sharks are dietary generalists or specialists using a
combination of stomach content and stable isotope analyses. Tiger sharks were
sampled during routine, standardized bottom longline surveys of the coast of Alabama
from 2009-2011. From Fall 2010 to Fall 2011, stomachs (n=48) and muscle tissue
(n=52) were collected. Gut contents were identified to the lowest possible
taxon, and avian remains (primarily feathers) were genetically identified.
Three metrics were calculated from gut content data: the Shannon index,
individual specialization and mean niche width. Individual isotope variation
was used to compare to individual gut content variation. By using this
combination of techniques, in concert with time series data from a standardized
coastal bird survey, we combine datasets across marine and terrestrial
ecosystems to evaluate the frequency of specialized feeding behavior in a known
generalist shark. While tiger shark populations consume a notoriously wide
range of items, identifying the extent that trophic strategy varies among
individuals is increasingly important in the face of management measures that
may impact only portions of the population (e.g. the recent harvest ban in
Florida).
Espinoza, Mario (Universidad de Costa Rica -
CIMAR); Clarke, Tayler; Villalobos-Rojas, Fresia; Wehrtmann, Ingo (Universidad
de Costa Rica - CIMAR)
Dietary overlap and resource partitioning of
four elasmobranch species off the Pacific of Costa Rica: implications for
management
Sharks and rays are believed to play a significant role as
top predators in aquatic food-webs, and presumably their removal can have
significant ecological consequences. Twenty-five elasmobranch species are
captured as by-catch in the commercial trawling fishery off the Pacific coast
of Costa Rica, which accounts for over 36% of its elasmobranch diversity. At
the moment Costa Rica lacks of adequate landing statistics, species-specific
catch data and basic biological information on demersal elasmobranchs. Therefore,
a better understanding of the distribution, diet composition, and ontogeneti
shifts of common demersal elasmobranch species was used 1) to assess the degree
of dietary overlap between species, 2) to identify feeding habitats and 3) to
generate management strategies. A total of 1174 stomachs from four elasmobranch
species were analyzed: Raja velezi (N = 512; 86% full), Mustelus henlei (N =
333; 83% full), Zapteryx xyster (N = 234; 80% full) and Torpedo peruana (N =
95; 58% full). Decapods were the most important prey item in immature R. velezi
, M. henlei and Z. xyster , particularly in the Central Pacific region, while
teleost fishes and stomatopods were more abundant in adults captured in the
North Pacific. All life-stages of T. peruana fed primarily on teleost fishes
along the entire Pacific coast. Dietary overlap was typically high between R.
velezi and Z. xyster, with little overlap between M. henlei and T. peruana. The
relative importance of crustaceans in the diet of elasmobranch species captured
in the Central Pacific region suggest that shallow coastal habitats may be
important for early stages. Additionally, differences in patterns of habitat
use and ontogenetic dietary shifts may be reducing intra and inter-specific
competition for resources. Management and conservation strategies for
elasmobranch species associated to trawling fisheries in Costa Rica should
focus on reducing by-catch rates and fishing effort in shallow coastal waters,
particularly in the Central Pacific region.
Bangley, Charles (East Carolina University);
Potential competitive and predatory interactions
between spiny dogfish (Squalus acanthias), and striped bass (Morone saxatilis)
in the coastal waters of North Carolina.
Spiny dogfish and striped bass are high-level predators in
the Northwest Atlantic ecosystem that have recently recovered from overfishing,
and both species overwinter in North Carolina waters. Striped bass and spiny
dogfish abundance, salinity, temperature, and depth data were taken from winter
trawl surveys conducted in North Carolina waters from 1996-1998 and 2006-2010.
Diet data were collected from striped bass in 2006-2007 and from spiny dogfish
in 2006-2007 and 2010. Spatial and dietary overlaps were determined between the
two species and the importance of striped bass in the diet of spiny dogfish was
assessed. Spatial overlap was consistently high and abundance was more strongly
correlated with environmental factors than the abundance of the other
predator. Dietary overlap was less
than 40% between striped bass and dogfish sampled in 2006-2007 but was over 84%
between striped bass a spiny dogfish sampled in 2010. Atlantic menhaden
(Brevoortia tyrannus) and bay anchovy (Anchoa mitchilli) were the most
important overlapping prey species. Spiny dogfish in North Carolina waters may
have consumed 0.91% of the striped bass stock during the winter. These data
suggest that spiny dogfish are occasional predators of striped bass and there
is potential for competition between the two predators, but these interactions
are insufficient to affect the abundance and distribution of either species.
However, the stability of these interactions may depend on the availability of
their shared prey.
Royer, Mark (Hawaii Institute of Marine Biology); Nosal,
Andrew (Scripps Institution of Oceanography, University of California - San
Diego); Lankford, Thomas (Center for Marine Science, University of North
Carolina Wilmington); Cartamil, Daniel; Wegner, Nicholas; Graham, Jeffery
(Scripps Institution of Oceanography, University of California - San Diego)
Foraging Ecology of the Leopard Shark (Triakis
semifasciata) in the La Jolla Ecological Reserve using Non-Destructive Dietary
Analysis
Leopard sharks (Triakis semifasciata) are a common inshore
benthic predator that is found along the west coast of continental North
America with a range extending from Oregon (USA) to the Gulf of California
(Mexico). While the feeding habits of northern populations in the bays and
estuaries have been examined, little is known about the southern populations
that reside in coastal habitats. Every year hundreds of mature female leopard
sharks aggregate at the south end of the La Jolla Shores beach within the San
Diego-La Jolla Ecological Reserve (SDLJER). This marine protected area consists
of a variety of coastal habitats including sandflats, rocky surfgrass beds,
kelp forests, and a submarine canyon. Tracking studies have revealed fine-scale
movement patterns of leopard sharks inside the reserve between the different
habitats. Insight on the foraging behavior of these sharks could explain their
movement behavior and their functional role in these coastal habitats. Stomach
contents were obtained non-lethally using the gastric lavage technique from
sharks sampled (n=87, 116-169 cm TL) in the surfgrass bed and sandflat at the
mouth of La Jolla Submarine Canyon inside the reserve from July 2010 to July
2011. Of the 87 sharks sampled, 46 (54.7%) contained prey itemswhich were
identified to the lowest possible taxon. The percent index of relative
importance (%IRI) was calculated for each food type to facilitate comparisons
between prey groups and other reported diets from northern populations. The
composition of major prey groups in T. semifasciata was heterogeneous,
consisting mostly of decapod crustaceans (%IRI =14%), teleost fish (%IRI=27%),
squids (%IRI=20%), octopi (%IRI=19%), gastropods (%IRI=4%) and mixed vegetation
(%IRI=10%) with 8% as unidentified digested matter. When the %IRI was examined
on the species level, it was found that the market squid ( Loligo opalescens )
which uses the submarine canyon as a spawning ground had the highest index of
relative importance (18.8%). The association of specific prey items to the
habitat types they reside in indicates that leopard sharks utilize each habitat
type within the SDLJER as a foraging ground. The prey composition of leopard
sharks sampled in the San Diego-La Jolla Ecological Reserve was entirely
different from the reported pre compositions of north populations with Cancer
gracilis being the only prey item overlap. This study helps gain insight on the
movement patterns of leopard sharks between habitats for foraging and the role
they have in trophic exchange between coastal habitats. Broader ecosystem based
modeling for the southern California coast and the designation of important
locations for Marine Protected Areas can utilize this information on the
functional role of leopard sharks.
Anderson, James (University of Hawaii Institute
of Marine Biology); Manoi, Kehau; Donachie, Stuart (University of Hawaii at
Manoa); Holland, Kim (University of Hawaii Institute of Marine Biology)
Investigating ecological connectivity between
distinct elasmobranch populations using oral bacteria: A proof of concept study
Ecological connectivity is a term used in reference to the
movement of organisms from one place or habitat to another. In a marine
context, understanding ecological connectivity has important applications in
conservation, and in fisheries management and planning. A synthesis of
knowledge from satellite tag derived movement data, as well as biophysical
modeling largely focusing on larval dispersal and reproductive phenology
demonstrates a level of inter and intra-specific connectivity in marine
environments at differing scales. These approaches have some significant
drawbacks including equipment costs, difficulty of data recovery, and
life-history specificity. This project begins to address connectivity among
elasmobranch species through the analysis of oral bacteria cultivated from the
teeth of live, line-caught sharks. Analysis of oral micro-flora will determine
the utility of this concept for elucidating connectivity. Here we aim to
describe bacteria, yeasts and fungi cultivated from the teeth of prevalent
shark species caught in waters around the Main Hawaiian Islands. We aim to
isolate specific marker species to provide real-time evidence of connectivity
between elasmobranchs at both species and population levels. These data can be
compared with satellite derived movement and habitat-use data t elucidate possible
connectivity.
Belleggia, Mauro (CONICET - UNMdP); Figueroa,
Daniel (UNMdP); Snchez, Felisa (INIDEP); Bremec, Claudia (CONICET)
The diet of Mustelus schmitti; a comparison
across decades
The diet of the narrownose smoothhound shark Mustelus
schmitti was studied based on analysis of stomach contents from two disparate
time periods from specimens on the northern Argentinean continental shelf (34 o
S – 41 o S): The first set of specimens was collected from fifteen
research cruises carried out by INIDEP from 1986-1994, total length ranged
between 250-1050 mm. The second set of specimens was collected from eight
research cruises from 2008-2011, total length ranged between 250-1050 mm. Prey
items were identified to the lowest possible taxonomic level, counted and
weighted. For comparisons, %IRI and the new %PSIRI were calculated. The
hypothesis that the consumption of each prey group is determined by intrinsic
(total length, sex, maturity) and extrinsic factors (region, season, period)
was assessed by fitting generalized linear models (GLMs). Of the 1009 stomachs
analyzed during the older period, 902 (89.39%) contained prey items. On the
other hand, of a total of 959 stomachs sampled during the contemporary period,
944 (98.43%) contained food. Only the stomachs containing prey were analyzed
further. The stomach contents of the narrownose smoothhound M. schmitti
indicate opportunistic foraging behavior. The specimens caught between 1986 and
1994 fed mostly on Brachyura crustaceans (65.53%), followed by polychaetes
(13.42%) and fishes (12.23%). The diet of those animals caught between 2008 and
2011 was composed mainly of polychaetes (38.12%) and Brachyura crustaceans
(30.64%), followed by fishes (17.82%). Hermit crabs were rare during the older
period (0.08%) but become more frequent during the recent years (7.38%). The
trophic level is the position of an organism within the food web; it ranged
between 3.76-3.92 during the older period and between 3.59-3.75 during the
contemporary period.
Bigman, Jennifer (Moss Landing Marine
Laboratories); Ebert, David (Moss Landing Marine Labs, Moss Landing, CA, United
States); Dewar, Heidi (Southwest Fisheries Science Center, NOAA Fisheries, La
Jolla, CA, United States); Bizzarro, Joseph (Friday Harbor Labs, Friday Harbor,
CA, United States); Kohin, Suzanne (Southwest Fisheries Science Center, NOAA
Fisheries, La Jolla, CA, United States); Vetter, Russ (Southwest Fisheries
Science Center, NOAA Fisheries, La Jolla, United States)
Spot a basking shark: how Californias citizen scientists can aid in the
recovery of an enigmatic shark
The basking shark (Cetorhinus maximus) is the second
largest shark species, reaching a total length of up to 10 m. It has been
reported globally from high latitude seas, including Arctic waters, to the
tropics. The eastern North Pacific basking shark population was recently
designated a Species of Concern by the National Marine Fisheries
Service (NMFS) for three main reasons: (1) notable, although largel anecdotal,
population declines; (2) a lack of recovery even after long-term cessation of
fishery exploitation; and (3) a severe lack of biological and fisheries data.
Although thousands of basking sharks
were observed off the
West Coast of the continental US and Canada in the early 1900s, individua sightings
are now uncommon and large aggregations and extremely rare and much reduced
compared to historic records. There have been no directed fisheries for basking
sharks in the eastern North Pacific for more than 50 years, but there does not
appear to be any notable increase in population size. It is unclear if this
situation is a result of persistent, undocumented mortality, the naturally low
intrinsic population growth rates of basking sharks, and/or potential changes
in contemporary distribution patterns. However, regardless of the cause, a
general lack of recovery following the cessation of fishing is common
worldwide. Without adequate knowledge of basking shark biology (e.g., movement
patterns, nursery and feeding grounds, demography) or fishery exploitation, it
has been extremely difficult to develop a recovery plan for this species in the
eastern North Pacific. To address this lack of knowledge, a collaborative
project was initiated in April 2011 between the NMFS and the Pacific Shark
Research Center to investigate spatial aspects (e.g., distribution, abundance,
occurrence, movement patterns) and population status of eastern North Pacific
basking sharks. This project has many facets including an outreach program,
tagging, data-mining, and a sightings network that have contributed to its
success and will be addressed in the upcoming oral presentation. The ultimate
goal of this project is to provide necessary baseline information for the
formulation of an effective recovery plan for basking sharks in the eastern
North Pacific.
Bond, Mark (School of Marine and Atmospheric Sciences, Stony
Brook University); Babcock, Elizabeth (Rosenstiel School of Marine and
Atmospheric Science, Univerity of Miami); Pikitch, Ellen; Chapman, Demian
(School of Marine and Atmospheric Sciences, Stony Brook University)
Differences in elasmobranch assemblages between
marine reserves and fished reefs on the Mesoamerican Barrier Reef
Our previous research has shown that Caribbean reef sharks
(Carcharhinus perezi) are significantly more abundant inside marine reserves
when compared to similar fished reefs on the Mesoamerican Barrier Reef. We now
pose the question: what effect have marine reserves had on the abundance of
other elasmobranchs, such as batoids? Rays, including the southern stingray
(Dasyatis americana), spotted eagle rays (Aetobatus narinari), Caribbean
whip-ray (Himuntura schmardae) and yellow stingray (Urobatis jamaicensis) are
not commercially targeted by fisherman in Belize. An appropriate null
hypothesis is that marine reserves have no effect on the relative abundance of
these species. Baited Remote Underwater Video (BRUV) surveys were conducted on
the fore-reef at four sites along the Mesoamerican barrier reef in Belize, at
two established marine reserves and two fished reefs (N=50 per site). Of the
combined 100 deployments at the two reserve sites 13 batoids were observed
compared to 58 observed at the two fished sites. We constructed a generalized
linear model (GLM) to explain the presence of batoids on BRUVs, which included ―marine
reserve‖, ―location nested within
marine reserve‖, habitat characteristics and
several environmental variables as potential factors. The GLM found that the
factor ―marine reserve‖
had a significant negative effect on the presence of batoids, while none of the
habitat or environmental variables had a significant influence (p>0.002). We
discuss ongoing research aimed at explaining this pattern, including potential
mechanisms such as (1) mesopredator release due to reduced predation from reef
sharks, (2) altered batoid behavior due to intimidation by sharks inside
reserves and (3) increased competition for prey inside marine reserves.
Henning 201, Sunday 14:00; Chair R. Dean Grubbs;
Symposium 10: Deep-water Chondrichthyans 2.
Verssimo, Ana (CIBIO - Research Center in Biodiversity and
Genetic Resources); Cotton, Charles (Virginia Insitute of Marine Science,
Canada); Buch, Robert (National Oceanic and Atmospheric Administration);
Burgess, George (Florida Museum of Natural History, Gainesville, FL, United
States); Gullart, Javier (Universitat de Valncia)
A revision of the gulper sharks (genus
Centrophorus) in North Atlantic waters
The genus Centrophorus (Squaliformes: Centrophoridae)
comprises a group of medium-sized benthopelagic sharks usually found on
continental and insular slopes of the Atlantic, Indian and Pacific oceans. Many
of the 10-12 recognized species are routinely caught in mid- and deep-water
fisheries worldwide and some have shown a considerable decline in abundance in
the last few decades. Despite the need for efficient and sustainable management
of these species, clear and consistent species discrimination and taxonomic
identification of Centrophorus is still problematic. The poor resolution of
diagnostic morphological characters coupled with the absence or poor condition
of the type material and the lack of detail in the original species
descriptions contribute to the widespread confusion in the alpha taxonomy of
the genus. We used molecular and meristic characters as well as detailed
morphometric measurements to re- evaluate and characterize the diversity of
Centrophorus in the North Atlantic, including the Gulf of Mexico and the
Mediterranean Sea. Molecular characters were obtained from nucleotide sequences
of the mitochondrial DNA cytochrome oxidase I (COI) and 16S ribosomal RNA (16S)
gene regions. Data were collected from fresh specimens caught by commercial and
research vessels, from preserved specimen deposited in museum and research
institute collections, and from publicly available databases (e.g. GenBank; BOLD) and the scientific
literature. Nucleotide
polymorphisms at COI and 16S separated North Atlantic Centrophorus specimens
into five well-supported groups consistently retrieved by both markers.
Morphometric measurements corroborated the existence of these five groups but
also indicated the presence of additional groups not represented in the
molecular matrix. We provide a morphological characterization of each group and
present a combination of morphometric measurements useful for species
discrimination in the field.
Comparison of North Atlantic specimens with those collected elsewhere
showed that four of the five groups identified above also occur in the Indian
and/or Pacific oceans. Our results extend the reported range of some species
considerably and suggest that most Centrophorus species have wider geograph
distributions than previously reported. Assignment of species names to each of
the morphotypes retrieved here is pending further evaluation of Indian and
Pacific specimens and a thorough analysis of all extant Centrophorus types.
Tanaka, Sho (Tikai University, School of Marine Science &
Technology); Nohara, Kenji (Tokai University, School of Marine Science &
Technology, Shizuoka, Japan); Burns, Finlay; Neat, Francis (Marine Laboratory,
Aberdeen AB11 9DB, United Kingdom)
Morphological and genetic comparison of the
genus Deania between European and Japanese waters
The genus Deania is a group of deep-sea squaloid dogfish.
Deania spp. inhabit worldwide along upper continental slopes at the depth of
400 to 1500 m and are caught incidentally with deep-sea longline fishery and/
or bottom trawl fishery. The genus is distinguishable easily into squaloid
dogfish by having a long snout, and currently contains 4 valid species from the
world; D. calcea, D. hystricosa, D.
profundorum, and D. quadrispinosum. Among them, D. calcea is known to
have considerable variation in the morphometric characters, especially with the
growth. Up to the present, 4 species were reported from Japanese waters: D.
eglantine Jordan & Snyder, 1902; Acanthidium aciculatum Garman, 1906; A.
rostratum Garman, 1906; A. hystricosum. Among them, the former three species
have been synonymized with D. calcea and there are two species, D. calcea and
D. hystricosa, in Japanese water at the present time. In this study, general
morphology of external futures and genetics were examined in Deania spp. from
European and Japanese waters. As a result, Japanese D. calcea was different
from European D. calcea in the length of the 1st dorsal fin base and the
distance between the 1st and 2nd dorsal fins. The species name will be
discussed with a result of genetic study.
Burgess, George (Florida Program for Shark
Research, Florida Museum of Natural History, Univ. Florida); Coelho, Rui
(Centre of Marine Sciences (CCMAR), Faro, Portugal); Schofield, Pamela
(Southeast Ecological Science Center, US Geological Survey, Gainesville, FL,
United States)
Advances in the taxonomic resolution of the
Etmopterus lucifer-complex in the Indo-Pacific region
Lantern sharks of the genus Etmopterus (Elasmobranchii:
Etmopteridae) are deep-sea sharks characterized for producing visible light
through epidermal photogenic organs (photophores). Within this group, the
Etmopterus lucifer complex forms a species complex characterized for having the
dermal denticles arranged in longitudinal rows. The worldwide distribution of
this group and the morphological and coloration similarities, historically have
resulted in difficulties in species identification. Adding to that, when
captured from commercial fisheries this group of sharks is usually discarded
due to their low to null commercial value, making the availability of study
material limited. Our review of this complex revealed the presence of five morphs
in the Australian region, including three undescribed species. The two
previously described species, Etmopterus brachyurus (known from Western
Australia) and Etmopterus molleri (New South Wales) are distinguished by their
elongate bodies and photophore and pigmentary patterns. The three additional
morphs newly described are provisionally referred to as finescale, dark and rough. The undescribed finescale (NSW and Queensland) is
distinguished by its dense curved
denticles, while those of both rough (an undescribed Great Australian Bight species) and dark (NSW and Tasmania) are more erect and
set in well-spaced rows. Rough
and dark morphs are separated by a series
of morphological and denticle density characters. Ironically, Etmopterus lucifer,
by literature attribution nominally cosmopolitan in distribution, is absent
from Australia and seems to be confined to the NW Pacific, where it was
originally described. This study represents and advance in the taxonomic
resolution of this species-complex, that until recently has been
poorly-studied. Such increased knowledge will allow for more detailed
(species-specific) data to start being collected, which will contribute for a
better management and conservation of this species group.
Straube, Nicolas (College of Charleston); Naylor,
Gavin (College of Charleston, Charleston, SC, United States); Ebert, David
(Pacific Shark Research Center Moss Landing Marine Laboratories, Moss Landing,
CA 95039, CA, United States); Corrigan, Shannon (College of Charleston,
charleston, United States); Li, Chenhong (College of Charleston, Charleston,
Canada); Rochel, Elisabeth (College of Charleston, Charleston, SC, United
States); Leslie, Robin (Branch Fisheries Management, Department of Agriculture,
Forestry and Fisheries, Roggebaai 8012, South Africa)
A molecular approach to estimate the etmopterid
species-diversity off South Africa.
The cold waters of the Benguela current on the South
African west coast and the subtropical warm temperate waters of the Agulhas current
on the east and south coasts in conjunction with the suitable habitat afforded
by the Agulhas and Mozambique plateaus, are believed to be the primary factors
driving high shark species diversity off South Africa. One of the most speciose
families of squaliform deep-sea sharks is the Etmopteridae (Lantern Sharks). An
estimated 13 species of etmopterids have been reported from South African
waters. The phylogeography and taxonomy of these species is debated in current
literature, as some etmopterids show a wide distribution range contrasting more
locally distributed species. Here, we present mtDNA analyses using the NADH2
gene (ca. 1000bp), applied to an extensive South African etmopterid sampling.
Preliminary results indicate the presence of at least one cryptic cold-water
species formerly referred to as Etmopterus cf. granulosus, as well as an
unknown warm water species from the Etmopterus lucifer clade. We further
discuss results in a phylogeographic context, i.e presence of widespread
species questioning the validity of some South African etmopterids considered
endemic.
Stehmann, Matthias F.W. (ICHTHYS Laboratory);
Dipturus nidarosiensis (Storm, 1881), a NE
Atlantic deepwater composite skate species
Storm prepublished without figures in 1881a note on Raja
nidarosiensis Collett (nov. sp. in lit.), based on correspondence with Collett.
Collett himself published in 1882 the full description of Raja nidrosiensis as
a new skate from Trondhjem Fjord, along with good plate drawings of his three
syntypes (immature male138 cm, two females 181.5 and 191 cm TL). Cannas et al.
published online in early 2010 molecular and morphological evidence of the
occurrence of Dipturus nidarosiensis (Storm, 1881) in the Mediterranean Sea,
based on 14 specimens taken from the deep Sardinian Channel at 600 to 1420 m
depth. These measured 240 to 1482 mm TL, including 9 adult females and the
adult male of 1180 mm TL. The habitus photographs by Cannas et al. (2010) of a
female 100 cm, a young male 24 cm and the mature male 118 cm TL from off Sardinia raised the authors doubts about the correct
identity of these specimens. The author had seen D. nidarosiensis
from the northern North Atlantic and reported in the literature, and these
showed a quite different habitus and were of markedly larger size of more than
2 metres, with beginning sexual maturity at a size even somewhat larger than
the maximum size of the Sardinian specimens. Iglsias (2009) had published on D. batis Linnaeus being a
composite species of a very large D.
intermedia and a much smaller D. flossada, just like with D.
nidarosiensis. When contacted, Iglsias wrote to eventually have found D.
oxyrinchus to also be a composite species with two forms of different
size. And he confirmed to have
provided the Sardinian colleagues tissue samples of D. nidarosiensis for their
comparative DNA analyses. He also confirmed to only know as D. nidarosiensis
from French catches and landings in and from southern Rockall Trough the
smaller form of the Sardinian morphotype, but he had never seen the larger,
probably more northern morphotype. Agreement of DNA analyses of his samples and
the Sardinian specimens was thus explained. Both morphotypes will be demonstrated, along with some contradictions in Colletts description, and the different
geographical range of both D. nidarosiensis forms. It
looks like, instead of fomerly three Eastern North Atlantic species of
Dipturus, we have to deal now with six species, with wide ranging consequences
for fishery management and conservation measures.
Weigmann, Simon (Zoological Museum Hamburg);
Stehmann, Matthias (ICHTHYS - Ichthyological Research Laboratory and
Consultancy, Hamburg, Germany); Thiel, Ralf (Zoological Museum Hamburg,
Hamburg, Germany)
Okamejei n. sp., a new deep-water skate (Elasmobranchii,
Rajidae) from the northwestern Indian Ocean off Sokotra Islands, with comments
on congeners in the area
A new species of the Indo-Pacific skate genus Okamejei
will be presented from around the Socotra
Islands and the slope off northeastern Africa. The 10 specimens of the
new species were sampled aboard the Russian RV Vityaz.
As is typical for the genus all specimens have dark ventral pores, a relatively
long, slender tail, a wide interdorsal space, and a long postdorsal tail
section. The new species differs from its congeners in having a unique
rosette-like dorsal pattern of numerous dark brown spots. The dorsal ground
color is ocher, but the anterior snout is dusky. Compared to its sympatric
congeners the new species for example has a shorter preorbital snout length, an
intermediate distance between first gill slits, a greater orbit diameter, an
intermediate number of upper jaw tooth rows and less pectoral radials. Furthermore, comments on the
questionable record of the Okamejei pita holotype from the very inner Persian
Gulf at the estuary off Iraq and its taxonomic status will be given. Additionally, a brief overview of some
other new taxa from the so-called Vityaz
collection will be given. This collection, which became property of the
Zoological Museum Hamburg in the 1990s, is a very rich collection of the
diverse but largely unknown deepwater chondrichthyan fauna in the western
Indian Ocean. Geographically, this deepwater survey ranged from the Gulf of
Aden to the southern end of the Madagascar Ridge at Walters Shoal. It included
remote and largely unknown localities, such as around the Socotra Islands, the
slope off Somalia and Kenya, the deep southern Mozambique Channel, the
Madagascar Ridge and the Saya de Malha Bank. Quite a number of new taxa of
deepwater sharks, skates and rays, and holocephalans have been discovered,
along with first geographical records of many taxa in partly large series.
Campana, Steven (Fisheries and Oceans Canada);
Fisk, Aaron (Univ. of Windsor, Windsor, ON, Canada); Klimley, Peter (University
of California, Davis, Davis, CA, United States)
Greenland sharks and their long distance
migrations to nowhere
Archival satellite popup tags (n=16) were deployed on
Greenland sharks (Somniosus microcephalus) up to 4.5 m in length, both in the
Canadian Arctic and off the eastern coast of Canada. Despite their large size,
most of the sharks were immature at the time of tagging. Tags remained on the
sharks for an average of 6 months before popping off. All tagged sharks
travelled a minimum of 150 km, and some as much as 1500 km, at depths of up to
1200 m. Migration pathways which took the sharks off the continental shelf, and
well off the bottom, beg the question: what the heck are these sharks doing?
Daley, Ross (CSIRO Marine and Atmospheric);
Home range and movement of Centrophorus zeehaani
on the continental slope off South Australia determined by acoustic telemetry
Expanding resource use has resulted in major population
declines in at least ten species of deep-sea dogsharks in the Atlantic,
Pacific, and Indian Oceans. Spatial management, including closures, has been
implemented to support recovery of two species off Australia. Transmitters with
depth and pressure sensors were fitted to Centrophorus zeehaani (n=70) to test
key a key assumption underpinning closure design: a proportion of individuals
remain resident within the closure.
Sharks were tracked using an array of 22 acoustic receivers moored on
the seafloor of the upper continental slope (200–700 m). Most sharks (n=52) survived to be detected more
than 20 times by at least two receivers. A minority of sharks (n=18) were never
detected on the seafloor of the study area and two sharks died on the seafloor
more than three months after
release. A clear diurnal pattern was evident with movements into shallow water
at night and returning to deeper water at dawn. Sharks ascended earlier in the
day and descended later during winter compared to summer. Observed temperature
range was mainly restricted to 10–13oC and most likely translates into a
narrow latitudinal range. Individual ranges along the slope (across longitude)
were contained within the closure but diurnal movements across the slope
regularly took many sharks outside the bathymetric range of the closure. The
narrow temperature and bathymetric range make this species vulnerable to
localised impacts. We conclude that effective spatial management measures can
be designed for deep-sea shark species when movement patterns have been studied
in detail and management arrangements can adapt to new data. However,
remoteness and isolation make design and monitoring costs high and cumulative,
depending on the number of species affected. Therefore we recommend that
development and management of deep-sea shark fisheries proceed more cautiously
than for the continental shelf.
Henning 202, Sunday 14:00; Chair Nick Dulvy; Elasmobranch
Conservation 3.
Mandelman, John (New England Aquarium); Cicia,
Angela; Coutre, Karson (University of New England); Driggers, William; Ingram,
Walter (NOAA (National Marine Fisheries Service)); Sulikowski, James
(University of New England)
The survival of rajids discarded in western
Northwest Atlantic commercial otter-trawling operations
Due primarily to regulatory factors, skates from the
family Rajidae are routinely discarded as bycatch during otter-trawl commercial
operations in the Northwest Atlantic Ocean, the gear type responsible for the highest annual capture and discard
biomass of skates in this region. Thus, post-release survival has a profound
impact on the overall fishing mortality, stock status and management of this
group. However, despite a presumed species-specific range in tolerance to the
rigors of trawl capture and handling and mounting management and conservation
concern, few studies have investigated the post-trawl capture
viability/condition or short-term (delayed) mortality among skates indigenous
to the Northwest Atlantic, and never under true commercial conditions in the
Gulf of Maine. We investigated the viability/condition and short-term (72 hour)
delayed survival of a mix of prohibited (Amblyraja radiata; Malacoraja Senta)
and target (Leucoraja ocellata; Leucoraja erinacea) skate species subsequent to
capture by otter-trawl across a
variety of capture conditions. Of the 1,288 skates evaluated, negligible
immediate mortality was observed in any species following capture, even in
relation to the most heavily packed and/or prolonged trawls. Aside from M.
Senta (41%), delayed survival
rates by species were high overall (82-92%), with L. ocellata (92%) the most resilient species.
Although factors varied by species, logistic regression modeling revealed trawl
duration as the most universal predictor of survival. The overt viability/condition
of skates at the time of capture was also a strong predictor of delayed
survival. Although in general Northwest Atlantic skates appear more resilient
to trawl capture and handling than previously estimated, species differences
must be accounted for when managing this group.
James, Kelsey (San Diego State University); Ferretti, Francesco
(Hopkins Marine Station, Stanford University); Moore, Jeff (Southwest Fisheries
Science Center, NOAA); Lewison, Rebecca (San Diego State University); Curtis,
K. Alexandra (Acadia University); Dillingham, Peter (Clark University)
Global Chondrichthyan Catch and Bycatch: Status
and Sustainability
Chondrichthyan populations are at risk from fisheries
catch and bycatch worldwide.
However, assessing the impact of fishing mortality on sharks and rays is
difficult given severe data limitations.
As a result, few fisheries management organizations have applied
management models to identify limits or reference points that could address
chondrichthyan catch sustainability.
In collaboration with colleagues, we are addressing this challenge by
creating a global catch database linking catch and bycatch data with
chondrichthyan life history, and developing reference point based models to
guide management of chondrichthyan catch. This project is a continuation of the
Project GloBAL bycatch database and builds on this foundation with ongoing work
by Stanfords Reconstructing Shark Baselines project. Here, we will review the
structure and content of our chondrichthyan catch database and its links with
demographic information, and discuss the application of management models using
these data. This collation and
synthesis of chondrichthyan catch and bycatch data will improve our ability to
assess and manage the impact fisheries are having on chondrichthyan populations.
Lotti, Matthew (University of Rhode Island); Wetherbee, Bradley
(University of Rhode Island, Kingston, RI, United States); Grace, Mark;
Driggers, William (NOAA/NMFS/SEFSC, Pascagoula, Pascagoula, MS, United States)
At-vessel mortality and related factors among
three carcharhinid sharks caught by fisheries- independent bottom longline
surveys in the U.S. Gulf of Mexico and the Northwest Atlantic Ocean
Mortality rates among commercially-caught elasmobranchs in
the US must be carefully monitored to ensure stock sizes are not declining past
renewable levels. Catch limits restrict fishermen from excess shark retention,
but if discarded individuals suffer high levels of at-vessel mortality, less
protection is offered by such management. The U.S. commercial bottom longline
fishery utilizes gear soak times in excess of 9 hours and this soak period that
has been shown to correlate to at-vessel mortality for many shark species,
especially among those that use obligate ram ventilation. The
NOAA/NMFS/Southeast Fisheries Science Center, Mississippi Laboratories bottom
longline survey utilizes only 1 hour soak times per set. However, even with a
reduced soak time, at-vessel mortality still occurs. The purpose of this
research was twofold: 1.To determine mortality rates for three shark species
commonly-caught by commercial bottom longline fisheries in the Gulf of Mexico
and western North Atlantic: scalloped hammerhead Sphyrna lewini , blacktip Carcharhinus limbatus , and Atlantic
sharpnose Rhizoprionodon terraenovae; 2. Investigate specific
biological, technical, and environmental factors correlated to at-vessel
mortality in light of a controlled soak-time. At-vessel mortality after 1 hr
was found to be >11% for S. lewini,
C. limbatus, and R. terraenovae. The probability of
at-vessel mortality was found to decrease for each species as length and bottom
DO content increased. For S. lewini, males were found to have a higher
probability of at-vessel mortality than females. Among C. limbatus, sharks
caught on J hooks were found to have greater probability of at-vessel mortality
than those caught on circle hooks. For R. terraenovae, the probability of
at-vessel mortality was found to increase with bottom water temperature. Restricting the commercial bottom
longline shark fishery from areas of low DO may decrease rates of shark
at-vessel mortality, and with it, potential discard mortality. Use of circle
hooks over J hooks is recommended to reduce at-vessel mortality among C.
limbatus . Additionally, fishing in lower temperature areas may serve to reduce
at-vessel mortality among R. terraenovae. These results may facilitate the
creation of more species-specific management for elasmobranchs.
Smith, Kieran (Florida Atlantic University Elasmobranch Research
Lab); Kajiura, Stephen (Florida Atlantic University Elasmobranch Research Lab,
Canada)
Elasmobranch Bycatch Mitigation
Commercial longline fishing results in large amounts of
incidental bycatch with elasmobranch fishes (sharks, skates, and rays) constituting approximately 25% of
the total catch. A variety of
techniques have been proposed to reduce catch rates of non-target species.
Teleost species, like swordfish and tuna, lack electrosensory systems so
developing technologies which target the ampullary organs in sharks may provide
an avenue to selectively deter elasmobranchs without impacting the catch rate
of target teleosts.
Lanthanide metals are extremely reactive when immersed in salt water and
produce an electric field detectable by the elasmobranch electrosensory system.
The employment of lanthanide metals to reduce shark bycatch has shown mixed
results. It is therefore essential that these metals undergo further
investigation in order to properly determine their effectiveness as a tool for
elasmobranch bycatch mitigation. A
controlled scientific longline study will be conducted to test the efficacy of
the lanthanide metal neodymium at reducing elasmobranch catch per unit effort
(CPUE). Baited longline hooks will
be treated with neodymium and catch rates will be compared to that of
controls. Preliminary data suggest
shark CPUE was decreased by 66% on neodymium treated hooks compared to
untreated hooks, whereas teleost catch rate did not differ. The effectiveness
of neodymium varies among species with significant reductions shown for
blacktip ( Carcharhinus limbatus ) and Atlantic sharpnose sharks ( Rhizoprionon terranovae ) but less
dramatic differences for other species indicating that interspecies variability may exist. Galvanic interaction between the lead control
and stainless steel leader created an electric field well within the range
detectable by elasmobranchs. Based
upon the large voltage produced by dissimilar metals in seawater, we devised an
alternative electrogenic stimulus.
The juxtaposition of two
metals with different galvanic potentials creates in seawater an electric field
nearly identical to the lanthanide
metals. Because a nearly identical
voltage can be generated with common metals, producing similar catch reductions
at a fraction of the cost, this alternative technology is potentially a viable
tool for reduction of incidental shark bycatch in commercial longline
fishing.
Blasius, Mary (California State University Long Beach); Mull,
Chris (Simon Fraiser University, Canada); Lyons, Kady (California State
University Long Beach); O'Sullivan, John (Monterey Bay Aquarium); Lowe, Chris
(California State University Long Beach)
Bioaccumulation and maternal transfer of organic
contaminants and mercury in young of the year white sharks (Carcharodon
carcharias)
Organic contaminants and total mercury were measured in young of the year
(YOY) white sharks (Carcharodon carcharias) incidentally caught in southern
California between 2005 and 2010. DDT and PCB concentrations were higher in
liver (76 87 μg/g ww and 14 10 μg/g, respectively) than in red (0.05 0.04 μg/g) or white muscle
(0.24 0.34 μg/g). Total mercury was higher in white and red muscle tissue (1.40 1.12
μg/g and 1.90 1.35 μg/g, respectively) than in liver (0.19 0.16
μg/g). These levels were alarmingly high considering
their young age and diet, suggesting these sharks are more likely acquiring these high levels from
their mothers in utero. To examine the YOYs potential of maternal transfer of these persistent
organic pollutants, a five-parameter bioaccumulation model was used to estimate the total loads
a newborn shark
would accumulate
over a one year period from consuming highly contaminated prey. Contaminant consumption was based on levels representative of fish
prey common in southern California.
Based on the model, the maximum potential levels that YOY white sharks could attain from dietary
exposure are 11.17 μg/g DDT,
0.6 μg/g PCBs, and 2.14 μg/g Hg. Observed organic
contaminant levels in YOY sharks were 7 fold higher for PCBs and 23 fold higher for DDT than the
maximum output of our model. Since it is unlikely these YOY sharks are acquiring such high levels from
diet alone (especially for DDT and PCBs), this suggests maternal transfer of contaminants
is a major contributing process to YOY white shark body burdens. Despite signs of population recovery in the eastern
Pacific, anthropogenic impacts via biomagnification and maternal offloading of environmental
contaminants may have
future impacts on
apex predator populations located around urbanized areas.
Lyons, Kady (California State University Long Beach);
Carlisle, Aaron (Hopkins Marine Station, Pacific Grove, CA, United States);
Blasius, Mary (California State University Long Beach, Long Beach, CA, United
States); Mull, Christopher (Simon Fraser University, Burnaby, BC, Canada);
Winkler, Chuck (Southern California Marine Institute, Terminal Island, CA,
United States); O'Sullivan, John (Monterey Bay Aquarium, Monterey, CA, United
States); Lowe, Christopher (California State University Long Beach, Long Beach,
CA, United States)
Levels of Organic Contaminants and Mercury in
Four Species of YOY Lamnid Sharks
During reproduction, females have the ability to transfer
accumulated contaminants to offspring by a process called maternal offloading.
Since organic contaminants are biomagnified through the food web, a mothers
the trophic level should highly influence the magnitude and composition of
contaminants passed to developing young. Liver contaminant concentrations were measured
in four species of young of the year (YOY) lamnid sharks caught in southern and
central California to compare the degree of maternal contaminant transfer from
females with varying diets. YOY white sharks (n=19) had the highest levels of
organochlorine contaminants among all four groups (PCBs 14 10 μg/g ww
[wet weight], DDTs 75 87
μg/g ww), followed by mako sharks (n=4; PCBs 7 7 μg/g ww, DDTs 13
75 μg/g ww), thresher (n=1;
PCBs 2.8 μg/g ww, DDTs 5.7 μg/g ww) and salmon sharks (n=17; PCBs
0.6 0.5 μg/g ww, DDTs 0.7
0.6 μg/g ww). YOY white sharks also had the highest level of total
mercury in their muscle (Hg 1.4 1.1 μg/g ww) compared to salmon sharks
(Hg 0.3 0.1 μg/g ww). YOY white sharks were also the only species to
show contaminant signatures (high DDT:PCB ratio) indicative of foraging from
the Palos Verdes Superfund site.
While diet and foraging location of YOY sharks may play a role, the amount of
contaminants accumulated by these young sharks is probably highly influenced by
their mothers. Therefore, adult lamnids such as white and mako sharks that feed
on highly contaminated marine mammals are more likely to pass higher loads of
contaminants to their offspring. The elevated contaminant levels of these young
animals are of concern since the physiological effects of these contaminants on
health and reproduction are unknown.
Shiffman, David (University of Miami); Gallagher,
Austin; Wester, Julia; Hammerschlag, Neil (University of Miami)
Catch and release recreational shark fishing in
Florida: economic, social, and policy implications
Catch-and-release fishing represents a non-extractive use
of sharks that furthers the frequently-used conservation principle that sharks
may be worth more alive (to ecotourism businesses) than dead (to extractive
fishermen). Recreational fishing is economically and socially important in the
state of Florida, and sharks are a popular sportfish. 137 charter fishing
businesses throughout the state of Florida that advertise shark fishing trips
were identified. Using content analysis of charter fishing business websites
and trade publications, as well as surveys of charter fishing captains, the
extent of the catch and release shark fishery was estimated. Catch and release
practices are commonly utilized by charterboat fishing captains, with only two
businesses explicitly advertising "catch and kill" practices. The
most commonly targeted species of sharks are mostly locally abundant, with the
exception of great and scalloped hammerheads, which are declining in population
and are the least likely to survive catch and release fishing. The wording used
by charterboat businesses on company websites and trade publications was
analyzed to show attitudes towards catch and release fishing. For many businesses,
shark fishing trips are the most
expensive service offered, suggesting that sharks are economically valuable to
these charterboat captains. Survey
results are also discussed. Applicable fisheries management policies are
reviewed.
Coelho, Rui (Centre of Marine Sciences (CCMAR));
Fernandez-Carvalho, Joana (Instituto Nacional de Recursos Biolgicos (INRB,
I.P./ IPIMAR), Olho, Portugal); Santos, Miguel (Instituto Nacional de Recursos
Biolgicos I.P. (INRB, I.P./IPIMAR), Olho, Portugal)
Hooking mortality of elasmobranchs caught in a
swordfish pelagic longline fishery in the Atlantic Ocean.
Hooking (at-haulback) fishing mortality of elasmobranchs
captured by Portuguese longliners targeting swordfish in the Atlantic Ocean was
analyzed. Information was collected by on-board fishery observers that
monitored 834 longline fishing sets between August 2008 and December 2011, and
recorded information on 36,067 elasmobranch specimens from 21 taxa. The hooking
mortality proportions are species-specific, with some species having relatively
high percentages of alive specimens at-haulback (e.g. blue shark, crocodile shark, pelagic stingray, manta,
devil and eagle rays), while others have higher percentages of dead specimens
(e.g smooth hammerhead, silky shark, bigeye thresher). Specimen size is a significant covariate for
calculating the odds-ratios of hooking mortality for the blue, the
crocodile shark and the shortfin
mako, with larger specimens having lower odds of being dead at-haulback. For
the blue shark, a multivariate Generalized Linear Model was calculated, and the
factors affecting at-haulback
mortality were specimen size, geographical coordinates (latitude and
longitude), year, quarter of the year,
vessel, and branch line material. To assess possible dependency in the
binomial response variable (dead or alive at-haulback), a Generalized
Estimation Equation model was calculated using each longline set as the
grouping variable. The correlation parameter in the GEE model was low, and the
parameters estimated with the GEE were similar to the GLM. The results
presented in this paper provide new information on the hooking mortality of
elasmobranchs captured as by-catch in this pelagic longline fishery, and can be
integrated in future ecological risk assessment analysis for pelagic
elasmobranchs. Additionally, these
results also provide new information on the efficiency of the recent
recommendations for the mandatory discards of some vulnerable elasmobranch
species mandated by ICCAT.
McCutcheon, Sara (Florida Atlantic University);
Kajiura, Stephen (Florida Atlantic University)
Lanthanide metals as potential shark deterrents
Sharks comprise a large portion of unwanted bycatch in
longline fisheries worldwide and various technologies and modifications to
fishing protocols have been proposed to reduce elasmobranch bycatch. Since
bycatch species are often trophically similar to target species, technologies
need to be developed to specifically reduce elasmobranch bycatch without
impacting the catch of target species.
Lanthanide metals have been proposed as an elasmobranch-specific
repellent. When submerged in a
polar solution, such as water, lanthanide metals undergo a hydrolytic reaction
and release electrons, which produces a charge distribution in the water. The charge produced by the metals
likely exceeds anything that sharks naturally encounter in the wild and will
presumably overwhelm their electrosensory system. We evaluated the efficacy of lanthanide metals as potential
shark deterrents. Specifically, we
quantified the electrical charge produced by six lanthanide metals in seawater,
compared their dissolution rates, and performed a behavioral assay to determine
effectiveness against two shark species.
We found that there was no difference in the voltage produced by the six
tested metals in ambient seawater. The charge distribution decayed as a power
function with distance from the metal sample. From the function for voltage decay with distance we derived
the function for the voltage gradient (ie. electric field). Based upon the median sensitivity
reported for six elasmobranch species, we calculated that sharks should detect
a sample of neodymium at a minimal distance of 65-85 cm. The dissolution rate for the
lanthanides varied from -1.6 to -0.2 g/h.
As the metals dissolved the voltage remained constant presumably due to
more extensive pitting which increased 3D surface area despite a decrease in
mass. In a behavioral assay,
neodymium was ineffective at repelling bonnethead sharks (Sphyrna tiburo) tested
individually and in groups, and lemon sharks (Negaprion brevirostris) in
groups. Therefore, due to high
cost, fast dissolution rates, and lack of deterrent effects, lanthanide metals
are not recommended for use in mitigating shark bycatch.
Corke, Jarrett (WWF-Canada); Wimmer, Tonya (WWF-Canada, Halifax,
NS, Canada)
Fishers' Knowledge for Elasmobranch Conservation
Bycatch and unaccountable discard mortality in fishing
operations are the primary threat to elasmobranchs in Atlantic Canada. Pelagic
and groundfish longline, mid-water and bottom trawl fisheries account for the
largest proportion of shark bycatch. Enhanced data collection is needed to
accurately estimate bycatch mortality, but additional important information on
non-target species catches in commercial fisheries can be accessed by direct
communication with fishermen. To gather this knowledge for WWF-Canada,
qualitative interviews were conducted with pelagic and groundfish longline
captains. The objectives were to:
1) through a mapping exercise, determine spatial and temporal distributions of
elasmobranchs and identify potential bycatch hotspots; 2) identify
modifications to fishing practices employed by fishers in response to
elasmobranch interactions; 3) identify methods to reduce and/or avoid bycatch;
and 4) describe fishers attitudes and perceptions towards elasmobranchs and
the bycatch of these species. This
study will be completed by the summer of 2012. Results thus far indicate that
fishermen have a considerable knowledge of elasmobranchs. Blue sharks (Prionace
glauca) were the elasmobranch species most commonly caught in both pelagic and
groundfish longline fisheries. Fishermen reported a significant change in both
the size and age blue sharks they caught over the past decade, potentially
indicating shifts in overall population structure of this species in the NW
Atlantic. A mapping exercise has also revealed the spatial and temporal
distributions of areas where certain bycaught species are consistently
encountered (e.g. Portuguese dogfish, Centroscymnus coelolepis). Significant conservation benefits can
be obtained from fishers knowledge, which can provide a real-time perspective
of the current circumstances on the water. Through integration of scientific
literature with the study results, a more comprehensive perspective may emerge
on the elasmobranch bycatch problem in Atlantic Canada. Furthermore, results
may inform the future direction of management objectives to further
elasmobranch conservation in Atlantic Canada.